GenePrediction:GLEAN_3202 Details

Name: GLEAN_3202
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:896932..898864 (+ strand)
Length: 1933
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:896932..897344 (+ strand)
Length: 413
Type: CDS
Source: GLEAN
Position: GCSC_161:897400..898864 (+ strand)
Length: 1465
>GLEAN_3202 class=GenePrediction position=GCSC_161:896932..898864 (+ strand)
ATGGCGTTTTCACGCGATGATTCTATCCAGGCTGAGCTGGCTCTACGGCAATCTCAGTCGCATTCGCTCGACGATTACGA
TTCTAGCGAGTCTTTTGCCCTTCTCTCGGACGACTCCCAGGGAATCGCTAGAGAGCATGACAAAGATAAGGGACATCCAG
AGAAAGCGCACCGGTCGCGAGAACTGGAAAAGGCTTCGGTCGAGCAGTCCAGGTCTCAATTGGAACATGTTGAAGATGGC
GCTGAATACGAAAGCATATCGAGAGGAGAGGTAGACGACGCCCGAGTTCGTGACTATATCCGAGCCGAACACGAACTCAC
CCTGTTACAAGCCGTCAACATGTACCCAATGGCCATATTTTGGTGCCTAGTGGCGTCGGCTTGCGTCGTCATGGAAGGAT
ACGACACTATTCTGTGCGCCTCTCCTCTGTGTTGATTCCTGCATCCTCTGTCTGACTCGCACGTGTAGGATTGGAAACTT
TTTTGCCTACCCTATGTTTGCAGCCAAGTATGGCCAGTTTATTGATACGCACGGTCAGCACCAGCTTACTGCAGCGTGGC
AGGCAGCTCTGGGCAACAGCTCGAGCGTCGGCTGCTTCCTCGGTGTCTTTCTCAACGGCCACATTGTCAATCGGCTTGGA
CAGAAGCGCGTTTTGTTGGGGGCGCTGCTTGGCCTGTGTGGCACCGTGTGTTTTACATTTTTCGCACCCAATATCGTGGT
GTTGATGATTGGCGAGCTGCTGTGTGGCATACCCTGGGGCATATTCGCGTCGTCAGCCCCGACATACGCATCTGAGGTTC
TTCCTTTGTGCCTGCGACCGTACTTGACATCCTACACAAACATGTGCTTTATCATTGGGCAGCTCATTGCGGCCGGCATT
CTCGCCGGCCTCGTGGACCGGACGGACGAGTGGTCCTTCCGCATCCCTTTTGCATTGCAATGGGCCTGGCCTGCAGTCAT
CACCCCAGTTCTCTTGCTTGCACCGGAATCGCCATGGCACCTTGTGCGCACCAGACAGTTGGACAAGGCCGAAGCATCGC
TATGCCGATTGCAGCGGCAGAGCACGGCTGGCTGCGATATCAACGCCAAATCCACGCTTGCCCACATCGTACAGACAAAC
GAGATGGAGAAAAGGGTGACTCCAGGGACTAGCTACTGGGACTGTTTCCGTGGCATCGAACGGCGCCGCACGGAAATCGC
GTGCATGGCTTTTGCAGGCCAAGTGTTGGCAGGATCGGCATTCGCGTACAACTCGACATATTTCTTCCAGCAGGTCGGCT
TGCAGGCGCACCAGACGTACATCCTTAACACGGGCGGGACGGCTCTAGCTTTTGTTGGTACCCTTGTCAATTGGTTTGCT
CTGATGCCCAGGTACGGCCGCCGACAAATCTATCTTTGGGGTATAATGTCGATGACGGCCATCCTTGTCATAATCGGCGT
TCTCAATATCTGGCTAGAGGAATCACGGGCAGTCGGTATGATCCAAGCCATCCTCACGCTCACATGGACGTTTGTCTTTC
AAGTTTCAATTGGCCAGCTGGGATGGACGATCCCAGCCGAGGTCAGTTCGACACGGCTGCGTCAGAAAACGGTGTGTCTT
GCGCGCAACTCCTACTATATCGCGCAGATAAGTGGCAATGTGGTACAGCCATATTTTATGAACCCGGATCAGCTGAACCT
GAAGGGATATGCCAGCTTCTTTTGGAGCGGCACGGCGCTCTTGACCTTCACATGGGCTTTTTTCAGACTTCCAGAGACAA
GAGGCCGAACATACGAGGAACTTGACTGGTTATTTGCAAAGAAAACACCGACTCGCAAGTTTGGCTCAGCACGCGTGCAT
GTTATCTTCAACCACGAACATGGGACTGCCGACGATTATGGCGAAGGAAATGAGGACGAGGATGCACACGAGATGGACGC
AATGGTGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62