GenePrediction:GLEAN_321 Details

Name: GLEAN_321
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1030710..1032025 (+ strand)
Length: 1316
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1030710..1030718 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_167:1031110..1031283 (+ strand)
Length: 174
Type: CDS
Source: GLEAN
Position: GCSC_167:1031344..1031425 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_167:1031488..1031641 (+ strand)
Length: 154
Type: CDS
Source: GLEAN
Position: GCSC_167:1031710..1032025 (+ strand)
Length: 316
>GLEAN_321 class=GenePrediction position=GCSC_167:1030710..1032025 (+ strand)
ATGGGTTTCGTTCCGCGTGGCGGTGGTGGCCGTGGTGGCTTCTCACGGGGTGGTGATCGTGGTGGCCGTGGTGGTTTCTC
TCGGGGTGGCCGTGGAGGAGGTAAGCAGAGATGATTTCCCGCAGCCGTGGCTGTGATCTGTCTTACTCACTCGAATAGCA
GGAGGTCCCAGCCGTGGTGGCTTCGGCGCTCGTGGTGGCGGTCGCGGTGGTGATCGTGGTGGCCGTGGAGGATTCTCACG
AGGTGGTCGTGGCGGTCCTGGTGGCCGTGGTGGCCGTGGTGGTGCCGCTGGTGCCGCTGGTGGCAAGAAGGTCGTCGTGG
TATGTATCTGAGCCTCCCACTCTGTGCTCTTGCTTTTGTCCTGTGCTGGATGGCCGACTGACCGCCCCTCTTTTGCTTAG
GAGCCGCATCGTCACAAGGGCATTTTCGTTGCCCGCGGTGGCAAGGAGGACCTGCTGGCCACGGCAAACATTGCCCCTGG
CATCTCTGTCTACGGCGAGAAGCGCATCACGGTCGAGAACTCGGTCAAGAACGAGGACGGTACGCCAGCAGGGAAGATTG
AGTACCGCGTCTGGGTAAGTGCTGATCAGCCTTTTGTTTTTTCTTGTCGGACCTATCCACTAACTCTGGTGCAGAACCCT
TTCCGTTCCAAGATCGCTGCCGGTATCCTCGGTGGTGTCGACAACATCTTCATGAAGCCCGGCTCCAAGGTTCTCTGTAT
GTATTGTCTGCCTGATCTTAGTGGGCTTTCAGATCGCTAACAGCCATTATCTGTCCAGACCTCGGTGCTGCCTCTGGTAC
GTCGGTGTCGCACGTTGCCGACCTGGTTGGCCCTACCGGAACCGTCTACGCGGTCGAGTTCAGCCATCGTTCGGGTCGCG
ACCTGATCAACATGGCCTCGAAGCGGCCCAATGTCATCCCCATCGTGGAAGAGTGCGTTGAACATCCTCCCGGGTTTCCG
GCTTCTTGTTGCTTAATCCGTTACTAATGGTTCTCCACAGTGCCCGTCACCCGCTCAAGTACCGTTTCATCGTCCGTACT
GTCGACTGCATCTTTAGCGACGTCGCCCAGCCCGATCAGGCCCGTATTGTGGCCCTCAACGCGAGCATGTTTCTGCGGCG
AGGCGGTGGCCTGCTTCTGAGCATCAAGGCCAACTGTATCGACTCGACCGCCCCGCCCGAGACCGTGTTCGCCAGCGAGG
TGCAGAAGTTGAAGGAGGACCGCTTCTTCCCCAAGGAGCAGCTGACGCTGGAGCCGTACGAGCGTGACCACGCGCTCGTC
GCGGCTGTGTACCTGCAGAAGGAGTTTGAGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62