GenePrediction:GLEAN_3222 Details

Name: GLEAN_3222
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:998644..1000690 (+ strand)
Length: 2047
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:998644..998689 (+ strand)
Length: 46
Type: CDS
Source: GLEAN
Position: GCSC_161:998878..1000569 (+ strand)
Length: 1692
Type: CDS
Source: GLEAN
Position: GCSC_161:1000632..1000690 (+ strand)
Length: 59
>GLEAN_3222 class=GenePrediction position=GCSC_161:998644..1000690 (+ strand)
ATGTGCAACCTCTTGTCAATCCCCGACGGACTGTTATGGACGAATCGTATGTAAACCCCTTTTCCTATCAAGATGGCAAG
TCTCATAAGGCGTCGAAACCTAGGTTTATCGGCAAAACAGGCGGAGAGATTTTCCATGAAATGATGCTGAGACATGGCGT
TGAACATATCTGTATGTCGTATAGCTTACTCGGCGTTACTCGGCGGCGCTCCCATTTGCTAACTATATTGTCAGTTGGAT
ACCCTGGTGGCGCTATTCTTCCTGTTTTTGATGCTATCTACAACTCGAAATACTTCGATTTTATTCTCCCTAAACACGAG
CAGGGAGCGGGGCACATGGCTGAGGGCTATGCCCGTGCGTCTGGAAAACCTGGAGTGGTTGTGGTCACTTCTGGACCTGG
TGCAACGAATGTCATCACCCCCATGGCCGACGCATTTACGGACGGCACGCCCATGGTCGTCTTTTCAGGCCAGGTTCCTA
CTTCGGCAATTGGCAGCGACTCATTTCAGGAAGCTGATGTGATAGGCATCTCAAGGGCCTGTACGAAGTGGAACGTCATG
GTAAAGAGCGTTGCAGAGTTGCCGCGCCGGATCAATGAGGCATTCGAGATTGCCACGAGCGGCAGACCCGGTCCTGTTCT
AGTCGACCTACCTAAAGATATCACCGCTGGCGTACTACGACGTGCGATACCAACTGATTGTGACATTCCTTCGATCCCGA
GCGCTGCCTCGCGTGCTGTGCAAGCACTTAGTGAGAAGCAGCTTGAACAGTCAATCTCCCGAGTTGCCGATCTGATCAAT
GTTGCTAAAAAACCCGTTATCTATGCTGGCTACGGCATCACATGCTCCAAGGGAGGCGTTGAGCTCCTCAAGGGGCTCGC
TGATAAGTCCTCTATACCGGTGACGACTACGCTCCAGGGCCTTGGGTCCTTTGATGAACTAGACGAAAAATCTCTTCATA
TGCTCGGCATGCATGGCTCGGCTTATGCTAACATGGCCATGCAAAACGCTGACCTCATTATCGCTCTTGGTGCACGGTTT
GATGATCGCGTCACGGGAAATATTTCCAAATTCGCACCTGGTGCAAAAGCAGCGGCAGCCGAAGGCAGGGGCGGCATTGT
CCACTTTGAAATTATGCCGAAAAATATCAACAAGGTGGTGCAAGCTACAGAGTCTGTCGAAGGGGATGTTGCTACAAATC
TTAAAATTCTTGTACCACAAGTCAAGGAAAGAACTCTGGATGACCGAAGGGAATGGTTTGCCGACATCAACGAATGGAAG
AAGCGCTGGCCTCTTTCTGCGTTCGAACGTGAGGAACGCGGTGGCTTGATCAAACCGCAGACTTTGATCGAGCAGCTCAG
CAATCTTACCGCTGACCGCAAGCAAGAAACAATCATCACCACAGGCGTTGGCCAGCACCAAATGTGGGCCGCTCAACACT
TCCGCTGGCGACACCCCAGGACTATGATAACCTCGGGTGGTCTAGGAACCATGGGCTTCGGTCTGCCAGCGGCTATCGGG
GCGAAGGTTGCCCGTCCGGATGCCCTTGTCATTGATATTGATGGCGACGCGTCCTTCAACATGACTCTTACTGAACTTTC
TACGGCAGCGCAATTCGGAATCGGCGTCAAAGTGATTGTTTTGAACAATGAGGAACAGGGAATGGTCACACAATGGCAAA
ATCTTTTCTACGAAGATCGCTACTCCCACACGCACCAAAAGAACCCTGACTTCATGAAACTGGCTGACGCCATGGGGCTT
CAACACCGGCGCGTGTCAGATCCCGCCGAGACGGTAGACAGCCTGAAGTGGCTGATCGAAAGCGATGGTCCGGCTCTGCT
GGAGGTCTTAACAGATAAGAAGGTTCCCGTTCTCCCCATGGTGCCAGCAGGGTCGGCACTACATGAATTCATAACATGGG
ATGCTGGTGAGTCCTATGCGCTCTCTCTATATTGGCGATTTTGTTTGCTAATATTTCTACGCTATCAGAGAAAGACAAAA
AGCGAAGAGAAATCATGCGCAAGCGCACTTTGGGCCTACACAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62