GenePrediction:GLEAN_3224 Details

Name: GLEAN_3224
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:1005448..1006663 (+ strand)
Length: 1216
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:1005448..1005968 (+ strand)
Length: 521
Type: CDS
Source: GLEAN
Position: GCSC_161:1006112..1006454 (+ strand)
Length: 343
Type: CDS
Source: GLEAN
Position: GCSC_161:1006652..1006663 (+ strand)
Length: 12
>GLEAN_3224 class=GenePrediction position=GCSC_161:1005448..1006663 (+ strand)
ATGAAAGCAGTGGTAGTTGACGGCAATCAATGCCGTGTCGACTATGAGCACATGATGCCCCAGTTACATGACTATCATGT
GCTTGTGAAGCCAGTTGCGGTAGCTCTTAACCCTACAGACTGGCGGCATCTGCGATACGGACGCGCCAAAAATGGCTGCA
TCGTCGGCTGTGACTACGCTGGCGTGGTCGAATTCGTTGGCAGAGGCGTGACTAAGGCATGGAGCCCAGGCGACAGGATA
TTTGGATGTGCCCATGGTGCCAACCTCGCTAATCCAGACGACGGTGTGTTTGCCGAGTTTGCTGCTGTTGTTGGTGATCT
TCAAATGCGAATACCGGATGAAATGGACTTTACAGACGCGGCGACCCTGGGACTGGGATCTATCACAGTCGGCCAAGGTT
TATTTCAAAAAGCTCTGAAGTTGGATTTGCCGGCCTTGACGATAATGAAAAAAGAAATTCCTGTCTTGATCTATGGCGGC
GGGACGGCCACGGGAGCGCTGGCTATCCAGTATGCTAGACAGTAAGTAAAATCCTGGAAGACGCCTTTTGCGCAGCAACA
GGATCATGACTGATGCCTCCCCCCCCCGCCTTTCTCTATTGATCCAGAGGCGGTTACACTGTCATAACCACTTGCTCGAA
GCACAATTTCTCTTACGTTGAGAGCCTGGGCGCAGATTTCGCCGTGGATTACCACGATGCAGATGCTGGCGCACAGATTC
GCGAATACACTAACAACAACCTATTCCATGCTTGGGATACTGTGAGCGTACCCCAGTCTGCGCAAATATGTGCCGACGCG
CTATCCACGCAAAAACATCAAACGCCCATATACGGTACCGTATTGCCGATTGGCAGTCCTCGTGCCGATGTAGAGACGGT
ATCAACGGTCATGTATACCGTCTTTGGCAAGGAATTTAAATTTGGCCCCGTCGTTGTACCAGCAAGCAAAGAGGATCTCG
AATTCGGCAAGACGTTTTCTGCTCTTACAGAGGCATTAGTGGCAGGAGTAAGTGTTGAAAACTGCCAAAGTATATATTCT
CCTGGAGGCTAATCAGTGATAGGACCGAATCAAGCCACACACATGCCGGATTGAGAGAGGCGGCCTTGAGGGGATTAAAA
AAGGCTTAGAGAGTCTGGAATCAGGAAGGGTGAAAGCCGAGAAGCTTGTTTACATGCTGACCGATTCTCTTGAGTCATAT
TAAGGATCTTCTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62