GenePrediction:GLEAN_3226 Details

Name: GLEAN_3226
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:1016949..1018982 (+ strand)
Length: 2034
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:1016949..1017514 (+ strand)
Length: 566
Type: CDS
Source: GLEAN
Position: GCSC_161:1017584..1018982 (+ strand)
Length: 1399
>GLEAN_3226 class=GenePrediction position=GCSC_161:1016949..1018982 (+ strand)
ATGGACGGCAATCTTCTTGTTCGTATGCTAGTTCTGGCCTCGGTTCGCCAAACCAGTTGTATGGTACATCATTCTCGGCT
TCATCACATACCGGGCTCGCGTTTACGCCATTATTCTTCGTCACTGCAAAGACTTCATGAAGTCCGTCTGGTTGAAGTTG
GGCCTAGAGATGGACTGCAGAATATCCAGGAGAGAGTCCCTACGGCTACCAAGATTGAACTTATACAGCGCCTAGCTGAT
ACCGGCTTGAAAAATATTGAAGCCACATCTTTTGTCTCACCAAAATGGGTGCCGCAGCTCGCCGACGGCGCTAAGGTGTT
GGGCTCTGTTCTCGGCTTCGCGGAGCAGATGAGGTTTGAAAAAGAGCCGCTCAATTTTCCAGTCTTAGCCCCTAACCTTA
AGGGCCTTGAGAATGCAAACGAAGCTGGCGCGAAAGAAATTGTGGTTTTTGCCTCCGTGACGGAACCTTTCAGCAGGGCC
AATCAGAACTGCAGCGTTGACGAAGCATTGCACCAGGCAGAGGCCGTCGCGAAGAACGCCTTGTCATTGGGAATGAAAGT
GCGCAGGTGAGTTACATCTCTGTGAAGCTGAAGAATACTCTATGATCAAGTAGGAGAAGATATAATTGCTCACAGTGATA
GCGTCATATCTTGCATTTTCTCCGACCCCTTTTCTGGACCAACACGTCCCGAGGCTGTCGTACCCATCGTGCAGCGACTT
CTTGACATGGGTTGCTATGAGGTCGGCTTGGGCGACACACTGGGCGTTGGCACACCCGCGGACGTTCAAAAGCTGCTACA
CGTCCTTCTTCCAGTGGTCCCGGTCTCAAAGCTGGCCGGACACTTCCATGATACCTACGGTCAGGGAATTGCAAACATTG
TCAAAGCGTATGATATGGGGATCCGCAACTTTGATAGCAGCGTTGCTGGTCTAGGTGGCTGCCCGTATGCACCGGGTGCC
AAAGGAAATGTGGCCACCGAGGACGTCATATACACGTTGGAAAAAGCTGGCATTCATACCGGTGTGGATCTCGAAAAGTT
GATCGCGGTTGGCCAGTGGATCTCCAAAGAGATTGGCATTCCGTATGGTAGCAGGGTCGGGGCGGCTCTTACGGCTACGA
AAGCTTCTCAAGGCGCGACCAAAAGAGAGCCAATTGGAACAGCGGGCTCCTTACCTGTGAAACCTAGTAGGACATGGGCA
ATTGTCCAGGATACTGGCGAATACCGACTGTCACGCGCAGGGACATGCATCAAAGTCACGCTAACACGTCCGAAGAACGG
CAACGCATTAACGAAATCGATGCTGGAAGGGCTCACGAGCTTCTTTCAGAATGTGGCAAAGGACCCAACTGTCTACCACA
TTGTTCTGGAATCGGAGGGCAAATATTTCTGCACCGGCATGGATCTAAGTGGTAAAACCAAAACATCTGACATGTCGGCT
GAGAGAAGTTACTATGACAGGGTTTTTGCCTTATACGACGCCATCGATCACGTCCCACAAACCACTATCTCCGTCGTGGA
TGGCCCCTGCTTCGGTGGAGGAGTGGGTCTCACGTTTGTTTGTGATGTTCGCCTGGTCTCTCAGCGAGCTCGGTGGACCC
TCAGCGAGATAAAGATAGGCGTGAGTCCGGCCGTGATCTCTAAGTTTTTGGTCCGGGAATGGGGCCCCTCAATGGCACGT
GAATGTATGATCTCGGGCCGGGAGATTCAACCGGAAGAGCTTGCTCGGGTGGGCGCAGTTCATGCCGTTGTGAAGGACTC
AGAGTTGTTGGCCGACCAAGTTGACGCATATCTTGACCAGTTGGATAGATGTGCGCCGCGGTCTGCAGCTATCAACAAGA
AGCTCTCTCGGCTAGGGTGGGACGCACCCGAGAGTGTAGCGCAGGCGGAGCTTATCAAAAGCACGTTTGCATGTATGATG
GCACCGAGTTCGGAAGGCGAGCACGGAATCCAGCAGTTTCGAAAAAAGCAGAAAACTTTCAGTTGGAGAGAATTTTGGGC
TGACCGAAATCCGTACAAGGGTTTTAATCCCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62