GenePrediction:GLEAN_3227 Details

Name: GLEAN_3227
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_161:1099664..1100519 (+ strand)
Length: 856
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_161:1099664..1099731 (+ strand)
Length: 68
Type: CDS
Source: GLEAN
Position: GCSC_161:1099808..1100519 (+ strand)
Length: 712
>GLEAN_3227 class=GenePrediction position=GCSC_161:1099664..1100519 (+ strand)
ATGCTTCGTTTCTTTAACGCCCCACACAAGGACAAGAATGAGATTGGCCTCCCTTCGCAGGAGCATGGGTACGTTTCTTC
TGTTTGTCCTTATAGCTTGGACTGCTGGGTAAAAACTTGGATTTAACTCGACCTATTTGTTTAGCTACGAACCTATCGGG
AACCATGCCGGGTTGCTGGATAGCACAAAGGACGGCTACGAGATTTTTAAAGTGTCGCGGGACGAGATCTCTAAGACAAG
CCCCAACCTGCCATTTATTGTTAATAATAAGGGCGATATTGAAACTCTACTCAGCTTCATCGCCGGATCCAACATTATAA
CCAAGACTATTCTCTCCTGCCTGTCTACAGCACTCGGCTTAACGGGGGCAGCCCGTCTCGAATACAGCCACCGCAACGAG
CACAAATCCAACAGCTCACTAGCTATGTTCCGTTACATCCCTGGCAGCTTAACGACAAGCAAAGAGATCGGCCATCAGAA
GCACACCGACATTGGATCTCTTACCCTGTTGTTCTCGGAGCAGTGGGGGCTGCAAGTGCTTCCTCCTCAGTCTTCCACCT
GGGCCTTTGTCGAGCCACGGCCGGGGCATGCAGTTATCAACGTAGGGGATTCGCTTCGGTTTGCATCTGAACATATGCTT
TATTCGTGTGTCCACCGGGTTGTCCCCTTTAATACTGCCGATGATCGGTACAGCATCGCCTATTTCCTCCGGCCCGAGAA
CGATGCCAAGTTCCTCGACAGCCAGGGACGTTGGGTAACGGCTAGTCAGTGGCACGACGAGAAGTACGACGTCTTCAAGG
TTTCTCATGGACAGCACAGTCCGGCGGATGCCATACTTCTTGGCGGGATGGCTTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62