GenePrediction:GLEAN_322 Details

Name: GLEAN_322
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1050854..1053319 (+ strand)
Length: 2466
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1050854..1050877 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_167:1050949..1051053 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_167:1051125..1051815 (+ strand)
Length: 691
Type: CDS
Source: GLEAN
Position: GCSC_167:1051869..1053319 (+ strand)
Length: 1451
>GLEAN_322 class=GenePrediction position=GCSC_167:1050854..1053319 (+ strand)
ATGCGCCTAGCGTGGTATGCTGGGGTAAGTGGATGGGAGGAGAACAGGCGCAGCTGGTCGGGACATAGCTAACGGTCTTC
TTTCTCATGCCACAGGCCTCTACGGCTTTAGCGGCCGGCGTGATCGTCTCGGCCTTTCACCAGCGGGCCAACTTCTACTC
GGCCACAGTCCATCTGTTCCAGAGCAACCTGAGTCTCATGGTACGTGACTCGTTCATCCCTCTGCTCCGTCCTTGTTGCG
GCTGACCGGTGCTTCCGATGCGCACGCACAGGTACTCGTGAACCTCACCATCCTTCTGTACTCGTCCCTCGTATACGGGC
TGCAACGAATATGCTACGGTCGGCTCCGCGCGGTCGAGGTCGAGCAGCTGTACGACAAGGCATGGTTTGCCGTGACGGAG
ACGTGCCTGGCCATGACCATCTTCCGCGACGAGATTGGTGGGTCGTTTATCGTGCTCTTCGTGGCCCTGCTCACCGGCAA
GGTCTGGGGTTGGATTGGCGAGGGTCGCGTGGAGGCGCTCGAGCAACAGCCACCGGCGAATCCGCGGCTCTTCCACATGC
GGCTCAGCGTGTCCCTCCTGCTCAGCCTAGGCTACGACCTGCTGCTGCTGCGCTTTGCGGTGCGCACAGTGATCCAGGCA
GCACGAGCCGACATGATGGTCATGTTCCTGTTCGAGTTTGCCGTCCTCTTTATCGCGTCGCTGCACATGGCCTCGCGCTA
CATGATTGTGCTGATGGACATCAACATCATCCGGAAGCAGACGCGGGACCGGTTGCAGGCCCGTCGCCAGCAGGTGCGCG
AGGAGCGGGAGGAGGTGCTGCGGCGCCGCGAGGCCGGCGAGGCCGGCGAGCCGGACGACGGGCTGCCGCTACCAGACGAA
GACGACATTGACGAGATGGACATTGAGGTGCCCGGCTGGGAGGCCAAGGGCCAGTATGTCCTTGGACTGGACCTCTGGAC
AGGTGCGTACGAGAAAGCGAGAAAGCGAGAAAGCTGGTTGCTGACAAACGTCCAGACTTTGTCAAGCTGTGCCTCTACGC
CACGTTTTTCTTTGTGCTGCTGACATTCTACGGACTGCCGCTGCACATCATTCGCGACCTCTTCATGACGGTGCGGTCGT
TCATCAAGCGCCTGGGTGCACTCATGAAGTACCGGCAGGCGATGCGGGAGATGAACAGACACCCCGACGCGACGGAAGAG
GAGCTGTCACGAGAGAACACGTGCATCATCTGTCGGGAAGATATGCATGTATGGGATGCCAACGACACGACGGCGGTCGA
GCGGACGCGGCCGAAGAAGCTGCCCTGTGGCCATATTCTGCATCTGGGCTGTCTCAAGAGCTGGATGGAGCGGCAGCAGG
TGTGTCCGACCTGTCGACGGCCAGTGACGGTCCACGAAGAGACGCAGAACCGGAATGGAGATGCGGTCCTCTTCCGGCTG
GGGCTGAACGTGCGTGGCGATCAGGGAGGCGACGGAGGCGCGGCTGATGGTGTGAACGCGGCGGCACAGAACCAGGGAGC
TGCCGGAGTTGCTGGGGTTGTTGGGGCTGCGGGCAGACTCCCTGCTCCAAACGGACAAGCGGGCGCCCACGTGAATGGCC
AGCTGGCCGACGGTCAACGTGGCGCGGCTGCTGTCAGGATGTTCAACTTTGGGCCCTTGAGGCTGGGCATCGCCCAGGGA
GGGATCCAGGACATACAGCAGATGGCTCAGCGTCTGGGCATCCCGGCGGCTGTGGCTGGAGCCGGAGCCGGAGAAGGGGC
AGGAGCGGGTGTTGGTGCTGGTGCTGCACCCCTTCCAGAAGCTCCGTTGCCAGGTGTACTGCCAAATGTACTGCCAGGCG
GACTTCCTGGCGGACATCCATTCCACGGAATGGCAGACCCGCTGTCGCCAGAAGCGATCCTGGCCGACATTCAGGCGATC
GAGCAGCGCGTCGATATGGTTCTGCGGCTGATGCAAAATGCATCTCTAGAAGCCCAGAACATGCGACACGTGATGACAGA
ATACATTCGTCTCCGACAAGGCCAAGAACCCACCGGTCCAACCACAGCTGCTGCTCCCGCGACTGCAACGACGCCTGTCC
GACTGGCAACAGACGCGACGGCACCCCCGATCCACGCAGGCAGCCCAGAGCTGCCAGCAGGCGTGCAGATCCCAACAGGC
TGGTCGCTGATCCCGCTGCAGCGTGCGAGCGAGATGTCAACAGCAGCCGCAGAGACAGCAGTGCCTGCAGTCCCAACCGA
ACAGCAGGCTAGCGGGTCCTCTAATGGGGCCGAGACGGCAAACACAGATTCGTTGAGCGCAGGGCCTAGCTCACAGGGAA
GCCAGACAACGTCTGCAGCCTGGAGGGAATCTGCACCGCTGCGGAGTCGAGTCAGCAGCGCCAGCAGTAATGCTAGCGAG
AGCGGCAGCAGTAGCTCGGGCTCGGACGGCCAGGTGGCAGCAGCTGGCGCCGACATGAGCAGCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62