GenePrediction:GLEAN_323 Details

Name: GLEAN_323
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1060653..1062540 (+ strand)
Length: 1888
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1060653..1060794 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_167:1061912..1062540 (+ strand)
Length: 629
>GLEAN_323 class=GenePrediction position=GCSC_167:1060653..1062540 (+ strand)
ATGGTAAACGGGGCTCAAAACGCAGATCCGTCATCACCTGGTCTGCTTCAGGGAGAGGAGTCGACCCAGGACTTCGTCGG
CACCCATCACGACAACTACCTTGAGTCCTCTAGCAGCTCACAGGACAGATCATCGATAGACGGTAAGAGCACTGCATCTG
TCCAGGGGACTGCAAATTGGATTATCTTCTGACTTTTGCATGGATTCTGTAGATTCAATTCTCTCCAAGTGGACGGTCCC
GATTTCGCTGATGACCATATTGTCCCTCGATGAAGAGCCTACTTCAGAGGAAGAACAGAAAGCCTTTTCCTCTGACAACA
GGACACAACTGACACATGATAGCGCAGAAGCATTATCAGCAGGGCTGGGGAATGAACTGTCGGCTGATACGAGAGCATTG
TCTCCTTCCCAGTCACCTCCAACAACACCAGTGAAGCGGCGAAACAAAACGTGCGTAGCCTTTCTCTGTTCATGACTTTC
GCCGAAAAGAGTGATGTAATTTAAATTCTCATTGATTTCATATCACAGATCTCAGTCACCGGTGACTTCGAATAGCCTTC
CAGCCTCCCAGAAGAGGGTGCAGAACAGAGCCCTGTTTAGTCTGCCAATCGAAAGCCTGCCGGAAGCAACCTGCACGATA
CCACCACGTCCATTGTTGGTTAGGGAAGGGGTGGAAGAATTGCACCCTCCCGAGTCTTGGAAGTGCAGCAACCCTCCGGC
CAGTGTGATGATCGGATCGGAATCGGAATCATTGCCATCGGCATCTTCCTACTATTCGGAAGAGTCAATTTCGGCCTCGC
AAGACGAAAGATTAGTTTCCCTGTCTCTCGATCTCTCAGGCATGCAGAGGGAGGTTCTTCAGATGGCAGCTGCAAGCCAC
GAGACCTTCTTGAGGCGGCTGACGGAGGAATGGGGCAACTCATCGGACGCGGCTTTGTACAAAGAGCTAGAAATGGAGAA
AAAACGCTGGATGCTGTCTGCTCTCCACAGAATCAACCCACCAGCAGATAGGGGGGTCGCACAGGTTCCTCGAGCTGACC
GACGCATTCTGGCTTTTTTTGAAAGCCACGGTGGGTTCATCGTCTCGTCTGGTCCGTGGAGACCATCAACTAACGCATAG
CTAGCAACGACATCGTATATTGCAGCTATGAATGTGGGAGTCCCGGTCCACCATATGTCGCCAAATCCTCTCTCTAGTCG
ACTGTTTCCGAACGTGTCGCCAATGGTGTTTTTGTCAGTGCCGTGCATGTCCATTTCAGTCGCACCGCAGATGTTTTCAG
ATATCTACGCGCAGACACTTCCGGTCCTCCTTTCTGCCGGAGAGATCCCGTCCTTGTTGCGCAGCATGCATTGTGTCCTC
AAGCCGCTAGGCACGCTGCACCTAATTCTCATGGACCCCCTACCAGTGGAGGCAACGCTGGGACCACGGATGAGGGCTTG
GCTGGAGGAACATCTGCTGATCAATTTAGAGCGACAGTTTCGGTGCGTAAACCCGACAACACAATTTCTGCCGTGGCTCC
GGGACGCACATTTCCAGCTTGGAGAGGGTGACAAAGTGGTGAGCAGGTTTCCGGCTGCTTTGCCTGACGTGTCTGGTGAC
AGCAGCATTTCCAGAGAAGTGTCTTCAGTCAAATTGGGCAATGGAAAGGGCAAAGAGAAGGCCGATAAAAACGAACAAGG
CACAAACGACAGGCAGCTCCGACTGCTTCACAATATTGTTGGACAGAAGCTGTGGCAGGATATATGGGGGTCATATGTGA
CGGCAGACCGGTGGTGGTGGGAGGATGCGTTGTGCCGCGAAGAATGCCTCAGACTGGAGACAGCGTGGGAGTATCACATC
CTGGGTGCCGTCAAAAAGAGCATGGCGCCAGGGGGTGGAAGGAACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62