GenePrediction:GLEAN_3249 Details

Name: GLEAN_3249
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:148589..150028 (+ strand)
Length: 1440
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:148589..148671 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_89:149352..149390 (+ strand)
Length: 39
Type: CDS
Source: GLEAN
Position: GCSC_89:149465..149564 (+ strand)
Length: 100
Type: CDS
Source: GLEAN
Position: GCSC_89:149644..149852 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_89:149920..150028 (+ strand)
Length: 109
>GLEAN_3249 class=GenePrediction position=GCSC_89:148589..150028 (+ strand)
ATGTCTCGCGGCGGCACCACTCTTTACGTCACTGGCTTCAGCCACGGCACGCGCGCTCGTGACCTTGCCTACGAGTTCGA
ACGGTACGTTTCTTAGACACTTACCTGGTTCTCCTCCATCCGCCTAGAGTCGACGATCGTCTACACTCGGAGACCCGCAT
CATTCGTTCATATTTTCTTCTCGGTCGCCTCGTCACATTCTCCTCCTCCGTTCCTCCTTCTTCTCCTCCCTATCGCGAGC
GGAACGATGCTCTCCGGCGCAGCCTACAGAGACCGCTTTGACCATCGTCCTCCGTCCTCCGTCCTCCGCTTTCCGTCCTA
CGTTCTGCGTCCTCTTCCGTCCGCCCCCCGTGTCCCCCCCAGATGCGCTCTTGCTATCGTGCCCCATACACTTTGGCTCC
CCGTCATGCCGATGCCTTCGCTACCGCGCCTGCTGTCGTCCCCACTCCAAAACCCGAAGCCGCGCGATGTCGGTCGCGAC
GTATGCATCCTGTTGCCTGACAGTCACTCCTCCCAACGAACGAGTTCGTCGTTACGCCATGGGCTGGAGTTCTTCTGCCT
GGCATTTGGTGAGGCAGGCCTGGCTCCAACCCCTCAACACCCATGCCATCTATCAGGAAGGATCGCACTCGCATTGCTTC
TGTACACATCCATGGCACAGAGGAAACGGCATGGCTGGCTCCAGACGGCCAACACCCCGCAGTTCACCTTCTTCCCTCAA
TGCTTGAAATAGACGCAGTGTTCTAACGATGACTGTCTTCTAGCTACGGACGCCTTGTCCGCTGCGATATCCCGGCTCCC
CGGTCAGCTAGCAGCCGCCTGTATGTAACTCTATGCATGTGCGGTGTATGCATCGGCTTGGCTAACCCTGTTCCAGGTTT
GCCTTTGTGGAGTACGAGGACCGTCGTGACGCTGATGATGCGTATCACGATATGCACAACAAGCGTATCGGTCGTGACGA
CATCCTGAAAATTGAGGTATGTTCATTGTCGTGTTTTGGTCTTTGAGATTGCCACAGCCCAGTGTTTCGGACGCTGACGT
GTTTACTCTTTACAGTGGGCCCGCACGCCTCCCTCTGCTTCATGGCGGTTCGATTCTGGCCGCGACCGCGACCGCCGCCG
CTCTCCGCGCCGTGGCGGTCGCTCTCCGTCTCCCCGTCGCCGGGACTATTCGCCTCGGAAGGATGACCGGCGAGACCGCG
ACCGCGACTACGACCGCGATTCCCGCCGTGACCGTGGTGATCGGTCCCGCAGCCCCGAAAACCGGTATGCCTCCTATACT
GATGGCAAGCATGCTTTCTATGCTACGGCCAATTGCTGACTCTGCTCCTAGTGACCGTGATCGCGACGCGAAGGACGACC
GCGACGACCGTGACGACCGTGACGATCGGGACGAGCGCCGCGAAAGTGCCACCAACGGCGACGACCGGAAGGGTGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62