GenePrediction:GLEAN_324 Details

Name: GLEAN_324
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1068200..1069318 (+ strand)
Length: 1119
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1068200..1068354 (+ strand)
Length: 155
Type: CDS
Source: GLEAN
Position: GCSC_167:1068417..1068456 (+ strand)
Length: 40
Type: CDS
Source: GLEAN
Position: GCSC_167:1068512..1068636 (+ strand)
Length: 125
Type: CDS
Source: GLEAN
Position: GCSC_167:1068709..1069214 (+ strand)
Length: 506
Type: CDS
Source: GLEAN
Position: GCSC_167:1069287..1069318 (+ strand)
Length: 32
>GLEAN_324 class=GenePrediction position=GCSC_167:1068200..1069318 (+ strand)
ATGTCCTCCTCGACCGCAGGACAAATTCCTGGGGCTGTCAAACTGTCCTATGATTTGCACTCTCCAGCCAAGCCGGTGAC
AAACCAGCATGTCCAGCCGATCATCTTTCTGCACGGTCTCTTCGGCTCTAAGAAGAACAACCGGAGCATAAGCAGGTAAT
TAGCAAGACATCCTCTTCCGATAAGACAACCGAGTTATGGTCTCTGATATCATGCAGGGCTCTCGCGCGTGATCTAGGCC
GGTACGTCTATGCGCCGGTAAGCTTGTCTGAGACTCTCTCTAGATGCCCGTCCGTTCTCACATATGTTGCAGGATGCTCG
GAATCATGGTGACTCTCCTCATAATCCACGCCATGACTACAATGCCATGGCCGACGATCTGGAGAACTTTATCCATGAGC
ACAAGCTTAAGGATGTCACCCTCATTGGACACTCCATGTAATCCGCGCCTTCCTCTCTCTCTGTGTGTGTCTATCTGCCT
CTCTCGCTCCGTCTCTTACTCTACCCCAGGGGTGCCAAGACAGCCATGACTTTGGCTCTGCGCCGGCCTGAGCTATTACG
CGACGTTATCCCCGTCGACAATGCTCCAATTGATGCCGGCTTGGTGAGCTATTTTGGCACTTACACCCGTGCCATGAAGG
AGATCGATCGTGCCGGTGTATCGCGTCACTCCGATGCCGACAAGATCCTGGAAGCATACGAGCCATCGCTGCCGGTGCGG
CAGTTTCTTCTGGGAAATCTGCATCGGGTGCACGTCAATGGTCACAATGTGCTGCGCTTCCGCGTCCCAATTGACATTCT
GGGGAAGGCCCTCGACAACATGGGCGACTTTCCGTTCCAGGATCCGCAGACAGCGCGCTTTGAGAAGCCCGCGCTATTTG
TCCGCGGGTCACACAGCAAGTACGTGCCTGATGAGGTGCTGCCAGTCATCGGCCAGTTTTTTCCGCTGTTTCAGCTCGTC
GACGTGGACGCGGGCCACTGGCTGATCTCGGAGCAGCCAGAGCAGTTCCGGCAAGGTATGTTATTTCCAAGGTGCAGCAA
GAAAGAGACATGGCCAGAGGAACGTCCTATATGCTGACTTGAAACAGCCGTTGTCCAATTCCTTGCACCCAAAGATTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62