GenePrediction:GLEAN_3250 Details

Name: GLEAN_3250
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:152370..153656 (+ strand)
Length: 1287
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:152370..152378 (+ strand)
Length: 9
Type: CDS
Source: GLEAN
Position: GCSC_89:152457..152792 (+ strand)
Length: 336
Type: CDS
Source: GLEAN
Position: GCSC_89:152995..153138 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_89:153212..153348 (+ strand)
Length: 137
Type: CDS
Source: GLEAN
Position: GCSC_89:153416..153656 (+ strand)
Length: 241
>GLEAN_3250 class=GenePrediction position=GCSC_89:152370..153656 (+ strand)
ATGGCTTCTGTACGTTTTCAGAGTCTATCCATTGCGCAATTTGAGAGAGCTGGCTGCGCGCATCCGCATATGCTAACATT
TTCTCAGGAGGATGTTCTTAAACCACCACCCCGGCCCGCCTCGTCCCCGGCGGTGACCCAGTTCTATAATTTCATATCCG
ATCCTCTGGTTGCCGCATTTTGTGGTGGTGGAGTGGCCGGTGCCGTCTCCCGCACCGTCGTCTCTCCGCTCGAGCGTCTC
AAGATCCTGTTTCAAGTGCAGAGCGCCGGGCGCACCGAGTACCAACTATCCGTGGGCAAGGCGCTCAAGAAGATGTGGGT
AGAGGAAGGCTGGCGTGGCTTTATGCGTGGCAATGGCACCAACTGCATTCGCATCGTGCCGTACTCTGCCGTACAGTTTG
GGAGCTACAATGCGTACAAGAAGGTAGGCCAAAGCACGCACGGCTCTTACCCGTCTCTGAGATTATTCCGATGGCTGACC
TTGTATGCAACCGCAGTTTTTCGAACCATATCCTGGGGCAGATATGACTTCACTTTCTCGCCTAATATGTGGTGGCTTCG
CAGGTATCACCTCGGTAATATGCACCTATCCTCTCGACATCGTGCGGACACGACTCTCCATCCAGTCAGCGTCCTTCGCC
GACCTGGGCAGCCGGCCACAAAAGCTACCGGGCATGTGGGAGACGCTGCTCTTGATGTATAAAAACGAAGGTGGCATGTT
GGCCCTCTACCGCGGCATCATTCCAACAGTAGCCGGCGTGGCACCATATGTAAGCATGTCCCCCCTGCTCATCTTTCTAA
CAGTTGAGGTGGATTTGTGGATTTGAAGCTGACCGTTGACAGGTTGGGCTCAACTTTATGGTTTATGAGGCAGCTCGAAA
GTACCTCACAAAAGAGGGCGAGCAGAACCCTTCGGCTGTGCGTAAGCTGTTGGCAGGTGCCATTTCCGGCGCAGTCGCAC
AGACCTGCACATATCCATTGTACGCACTCCCGGGTTATCCAATCCATATGTATTGCTACATACCAAGACTGACATTCGCC
CGACAGTGACGTGCTGCGCCGCCGATTCCAGATCAACACCATGTCCGGCATGGGCTACCAGTACAAGTCAATATATGATG
CTATCCGCGTCATTGTTATGCAAGAAGGACTGAGGGGTCTTTACAAAGGTGTCGTCCCGAATCTGCTAAAAGTTACGCCT
AGCATGGCGTCCAACTGGCTAAGCTTTGAGGTAACCAGAGACTTCCTTGTCGGCTTACGTCCCGAGCCGGAAGACATAGC
ATCATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62