GenePrediction:GLEAN_3251 Details

Name: GLEAN_3251
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:154395..155623 (+ strand)
Length: 1229
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:154395..154398 (+ strand)
Length: 4
Type: CDS
Source: GLEAN
Position: GCSC_89:154914..155018 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_89:155111..155481 (+ strand)
Length: 371
Type: CDS
Source: GLEAN
Position: GCSC_89:155546..155623 (+ strand)
Length: 78
>GLEAN_3251 class=GenePrediction position=GCSC_89:154395..155623 (+ strand)
ATGGGTACGTGAGAGATTACAGCATTCTTCCTGAAATATGGGAGAACGGCTCTTGTTAAGAGTGTGCGAGTGGAGGGAAG
CTGGAGGGTGATGACGGACGAGGCAGTCAAAGGACCGAAAGAGAGAGACAGGGAATATGAGGTCGGCGATTGATTGGATC
TATCCGCCCTGGAAAATGGGCTGAACATGACCATCTCTCTCCCTTCCTCCCTGTCGATGATCTTGATCGTCCTCTTGTGC
TCCCCCGCCGCCACTGCCCTACTTCTTCCCATCTGCGAACCTTGGCATTGGTGTCGAGCGATTGAGGCTGGCAGCTATTT
TCATTCTTTGATCTCACCCCTGGACGGGGAAGGGGGAAGAGAAAGACATGACGACGGCTGCTTTCCTCTCTCGGTTCTAT
CTCGACCCAGCCATCTGTTCCAATTTTTACAAATTGTTTTCTGAGCATACCAAAGAGACCAAATCGGCTGACTGGGAGGA
CACGACCTTTTCGGTTTCTTTTTCTTTGTTTTTATGTAGGTATCGATCTGAACAAGAAGCACGTGCGGTCTACGCACCGC
AAGGCGCCCAAGAGCGACAACGTCTACCTCAAGCTGCTCGTGAAGCTGTACCGCTTCCTTGCTCGTAAGTTATCTCCTCC
TTCCGTTTTGGCTCTTGGTTCTTCTTGACCGTGTCGTCTGTGGTACTGACAACGGTATCCTAATCACCTCCGCCAGGCCG
TACGGACTCTTCATTCAACAAGGTCATCCTGCGCCGTCTCTTTATGAGCCGCATCAACCGGCCTCCCGTCTCGCTCTCGC
GCATTGCGGCCAACACGCGCAACGGTGACAGTGCCAAGAAGACGATCGTCGTTGTCGCCACCATCACCGACGACAACCGC
CTGCTTAAGGTGCCCAAGCTCGACATTGCTGCCCTGCGCTTCACGGCTACGGCCCGCGCTCGCATCGCTGCTGCCGGCGG
CCGTGCCCTGACCCTGGATCAGCTTGCGCTCGAGAAGCCGACTGGTGCCAACACGCTGCTCCTGCGCGGCCCCAAGAACG
CTCGTGAGGCGTTCAAGCACTTCGGCTTCGGCCCGCACAGCCACAAGGTCCGTCCACACCCTACTCCTGTCTTTTTTCTT
CTGTTCTTTCTCTCTTCTAACCCCATTATAGAAGCCCTACGTCGCATCCAAGGGCCGCAAGTTCGAGCGTGCTCGTGGCC
GGAGACGGTCTCGCGGCTTCAAGGTCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62