GenePrediction:GLEAN_3252 Details

Name: GLEAN_3252
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:158276..159345 (+ strand)
Length: 1070
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:158276..159164 (+ strand)
Length: 889
Type: CDS
Source: GLEAN
Position: GCSC_89:159212..159345 (+ strand)
Length: 134
>GLEAN_3252 class=GenePrediction position=GCSC_89:158276..159345 (+ strand)
ATGTATGCCCTCCGCCCCTCCTTTGTGTCCCAGAACTTCCCCTGGGCTCCGGCATTCACGGAAAAAAACCTTCCGGATCT
CTCTGGTCGCGTCTACATCGTCACGGGGGCAAACACCGGAGTCGGCCGCGAGCTCACTCGCATACTCTATGGAGCTAACG
CTATTGTCTATCTGGCCTGCCGTTCCGAGACTAAGGGCCGCCAGGCCATAGAAGAGCTCCAACTGGCAGCCACTCCCACT
CACGGCCGTCTCGAGTTCCTGCTGCTCGACTTGGCCGACCTGCGAAGCATCAAGCCTGCGGTCGATGTCTTTCTCGCGCG
CGAGTCACGCCTCGACGTGCTGTTCAACAACGCCGGCGTCCTAGTGCCGCCCGAGGACGAGCCCAGGACGGCGCAGGGCT
ACGACCTCGAGATCGGGGTCAATTGCTTGGCGCCTTTTTTGTTCACCCGCCTGCTGACACCCATGCTGGCAGCAACGGCC
AGGTCTGGCGAAACGACGCCTCCCGGCAGCGTCCGCGTTGTCTGGGTTTCGTCCATCGCCGCCGAAATGTCGGACACTGG
CGGCATCGACGTTGTCAACCTGCCTGCTACCACCCCTTCTTCACCCATCTTTCTTGCAAAGTACGCTGCCAGCAAGGCAG
GAAACTATCTGCATAGCACCGAGTTTGCTCGCCGGCACCGTGTCGACGGCATCGTTAGTATCGCCGCCAACCCCGGCAAC
CTCGATTCCGACCTCTACCGCAACTCTGACAACAAGGCTGGCCTTTTGCATACGCTCGTCATGAAGGCCTTTGTCCGCTT
CATGCTGTACCCTTCCGTCTACGGCGCCTACACGGAGCTGTTTGCCGGTCTGTCGCCAGACGTCACGCTGGACAAGTCTG
GTGGATGGAGTGCGTGTCTCTACCCCTATTGTTGCGCTCTTAGCTAATCCAAGCAGTCGGCCCGTGGGGCCGCTTCCTCA
GCATGCGCAGTGACATTCTCCATAATGCCCAGCCCAAGTCCGAGGGAGGTGGCGGTGGCGGCGAGGCATTCTGGGACTGG
AGCGAGGAGCAGGTGAAGCTGTTCATGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62