GenePrediction:GLEAN_3253 Details

Name: GLEAN_3253
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:162260..167107 (+ strand)
Length: 4848
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:162260..162604 (+ strand)
Length: 345
Type: CDS
Source: GLEAN
Position: GCSC_89:162675..162775 (+ strand)
Length: 101
Type: CDS
Source: GLEAN
Position: GCSC_89:162847..163202 (+ strand)
Length: 356
Type: CDS
Source: GLEAN
Position: GCSC_89:163274..163454 (+ strand)
Length: 181
Type: CDS
Source: GLEAN
Position: GCSC_89:164165..164280 (+ strand)
Length: 116
Type: CDS
Source: GLEAN
Position: GCSC_89:164357..165468 (+ strand)
Length: 1112
Type: CDS
Source: GLEAN
Position: GCSC_89:165831..165861 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_89:165936..167107 (+ strand)
Length: 1172
>GLEAN_3253 class=GenePrediction position=GCSC_89:162260..167107 (+ strand)
ATGCGCTGGTTCTCGCTGCTCGTCTCGTCCGCCTTCGTGGCGGGCTCCCTCGCCGCTGCTCCCAAGGCCGATCTGTTCCT
GGACTTTCATGCCCAGCAGCTCTCTTCGACCCCCATCAAGATCAACGATGCCAAGTACGGCAAACTTATCAGCGCACAGC
GCAACTACAGCTCGGTCGTGCTGCTAACCGCCATGGACGCCCGGTTCGGCTGCCAGCTGTGCCGTGAGTTCCAGCCCGAG
TTTGACCTGCTGGCCCGCAGCTGGACCAAGGGTGACAAGGCTGGCGAGTCCCGGGTCGTCTTTTCCTCGCTCGACTTCAA
CGAGGGTCGGGAGACGTTCATGTCGGTATGTGACGGCAGAACGCCTCTGCCACGCACTTGGGGCCCTCGAGGCTAATCCG
GTTTCTTCTGCACAGCTCGGCCTCCAGACGGCCCCCGTCCTCTTCTTCTTCCCGCCCACAGCCGGTCCGTTTGCAGTCAG
CAAGGCCGACCCAATCCGCTACGACTTTGGCAATGGGTACGTTGCGGGCTGAATGACTGAAAGACAGGACGACAATGTAC
AGACGCTGACAGGCCGTTGCTCATCAGTCCCGGCAAAGCTGAGGTGGTCCAGAACTGGCTGGCACGCCACCTCCCTGACC
GGCCTCACCCGCCCATCCAGCGTCCGATCAACTGGGTTGGCTGGGCCACCGGTATCACCATTTTCTTGGGTGCGATCACA
ACCCTGTTTGTCGCTTGGCCCTACGTTCTCCCCGTTGTCCAGAATCGCAACCTCTGGGCGGCCACCAGCCTGATCGCCAT
TCTCCTCTTTACCAGCGGCCACATGTTCAACCAAATCCGCAAGGTGCCCTACGTGACCGGAGACGGTCGCGGTGGCATCA
CGTACTTTGCTGGCGGGTTCCAGAACCAGTTCGGAATGGAGACGCAGATTGTCGCTGCTATGTGTAAGAATTATGCACAC
TTTGGACATTTTGTCGGCTTGTCGCTGAGCGGATGCTGACCTCTTGTCTACTAGATGCCGTGCTGTCGTTCGCTACGATT
TCTCTCGCCATCAAGGTACCGAGAATCACGGACGCGCGGACGCAGAAGCTGGCTGCTGCCATCTGGGCCGGTGTCATTTT
CGTCATGTACAGCTTCTTGCTGAGCGTCTTCCGCATGAAGAATCAGGGCTACCCGTTCTCCCTGCCTCCGTTTATGTGAG
CGCGGAGAAACGGGTGTCACGTTAGCGGCCCGGAGAGATGAAGCGTAAAGACATGACTGTGGTGCACCTACAGGGACAGT
AAAATATGTTGTAGGCTGGCCAAGGTGCATGACGGCGGGCGAGACAACAGGGGAGAATGGAACGCAGTCGACATGTGTAC
AGTTAAACTCAGCACGAAGGGTGACATAAAAGGAGCAGTGTTAGATTTTAGCCCTGGATGGTAAAAATGTACGGATAACA
TGGGACGTCGGTCAATTTCTAGACGGTTACAATCGATTGTTGTAAACTTGTCGTTGGGAGCAATAGCCTTCATCAGAATC
ACGTGCTACCTCACATGTCCCTCTGGCCCGAACCGCCGCCGGCTAAGCTGAGAATGGAAAGCGGGGCTGGCCATTTACAC
GAGCAGGACCGGAATACGGCTATAGTTGCCCCGAAAGACCCGAGTTTGGGGACCCCATGTGGCCAGTGATTTTATTTGCA
ACCTACACGTACACATGCAATTTCGGCTTCTCGCCGGGTAGTGGGTCTGCAGTTCTTCGCAGCTTCTTGTGCACTGGAGA
GACATGTCTCGCGTTGGTTGTGTGGATTGACGTCCTCCGACCCGTCTCTTGACTTCCGCTGGTCCTTGGAGCGGCCACAG
CCGAACGTCTGCCTAGCTGCCACAACGGCGATGGGAGCTCTCCGGTTTCTGCCCCTGCGATGCAGCCGCCACACGCACTG
CACCGCGCGGGTAGCACATCAACGGCGAGCGGTATCGTCGTCGTCGTCGATTCCGCTGGCAACACCGCGGCCGCGGCCAA
AGACGGCAATCTTCTTTCCAGGTGGGTGCGCATCTTGTCAGCTTGTTCCCTCTTCGATCGGTGGCGGTGCCGGCTGCTGA
CACAGATGCTCGACCAGGCCAGGGCGTGCAGAGGGTGGGAATGTTGACGCCGTGGCTGGAGGCGTTTCCGGCGACGACGC
GCGAGACGATGGAGGAGATTGACGACTGCATGGGATACCGGCTGACGGAGGTGATTCAGTCGGGGCCAGGACGACTGCTA
ACGGCGACGGCGCAGGCACAGCCGGCGATCATGGCGACGTCAATCCTGATCGTTCGGGTGCTGGAGCGCGACTTTGGGTT
CCGGATATCCGAGCACATGGACGTGACGCTGGGACACTCGCTGGGAGAGTTTGCGGCACTGGTGGCAGGTGGCTACCTGC
AGTTTCGCGACAGTCTCTGGCTGGTGCGACGGCGGGCTGAGGCGATGGCCAAGGCGACGCGGCAGGCGGTGACAGCGCAC
GGCGGCGGCGAGTACGGCATGGTGGCGGTGCTGACGGAGCCTGAGTATCTGCCCGGCCTCGTCAGGGCGATCGAGCGGAT
TCTGGGGGAGAAAAGACAGACACCACTGCTGTCGTCGTTTTCGCTGCCGTCGCTGTCGTCGCTGTCGTCGCTGGACCTGA
CACCGCCGTCGCCGTACGTTCCGTTCTGCCATCCGGCGCCGGTACACATTGGCAATATCAACAGCAAGAACCAGATTGTG
CTGAGCGGCAGCATCGAGCGGATTCAGCGGCTTCTCGGCCAGGTGCGGCAGTTTATGGGCCACGATCCGCGGGCGGTGCG
GCTCAGCAGCGACAGCCCTTTCCACTGCGCAATCATGCGGCCGGCCGTGGCGGAGATGCGGCAAATGCTGGAGCAGGAGC
GGCCGTGGGCGGTGCAGTTTCCAGGCCGGCTGCCATGCATCAGCAACGTGACGGCGCGACCGTTTAGCAGCCGGCCCGAG
CTGACAGAGCTGCTGGCGCGCCAGTGCGAGGAGACGGTGCAGTGGTGGGACAGCATCCGCTACCTGGACCAGGAGCAGCG
CGTGCGGCGCTGGGTTGGCATTGGGCCCGGAAAGGTCGGCCGCAACCTAGTCGGCAAGGAGGTCGGCATGCGCGGTAAGG
ATCCGGTCAAAGGTGGCGGCGTGTGGGCCATCACAGACCCTAGCGAGATCGAAGAGGTGCTGCGGGGACTAGAGGAGACC
GAGTCGTTTGTCGACGAGGAGTGAGCTGTCTGCGTGTCCTGTGTACGAGTGTTCTGGGTGTCTGGCTTGAATCTGGGAAA
ATGAGGCTCTAAATTGGACATTGTAGGATATATCCTTTACTATACAGAGTACTACTATTGTTATGTACACCGACCACGGG
GAAGGTGCAGATAGGCTGGAGGCTACTACGGAGTATGTAGCGAGGCAGGCGCGACCGCTGATGACTAGCGGTGACTGCCC
GGCTCCACTGCTGATGCAGCCGGAAGACCCACTAAAGTGCAGCCTTGACATTTGGATTCTAGCTATTGCCACTTGTCTTG
GTCCTTTGGCTTGACATGTTTGTGGACGTGCTCTTCTTAATGTCAGTTTAGTTTACCCTCTTGCCTGTCGACATGTCCCA
CAGTAAGCTTCAGCTTTCCGAATCTATGCTCCTGTCTCGTCCTCTCGTCCTCTCGTCTGCCCTGCTAACCTACCAGGCAA
GCGCAACACCAGCCGAGCCGTCTTCACGGCGCACGAGCGGTCGCTGGCCAAGGCTGCCTGGACAGTCTCGTCGGCACGGT
TGACGCGCGAGTCGTTTCTGCCCTTTGGCGCCTGCGCCCTCTGCCTAGAGCCGGCCCAGGACCCGGTCGCCTGTCCAGCC
GGCGACGTGTTCTGTCGCGAGTGCGCGCTGCGCAACCTGCTGGCCCAGAAGCAGGAGCTGCAGCGGCTAGATCGTCTGCG
GGCACAGGCTGAGCGTGATCGTGAGGAGTACCGTCTGCGTGAGGCCGCCGAGGATGAGGCTCGTGCCGTCGTGCAGTTCG
ACCTCGTGCAAGCAGGGTTGGGAGGAGGAGGAGGCGGCGGCGAGGTGAGGCTGCGAGACGAAAAGCAAGAACGAGAAACT
CGGTCAAAACCTCTGCTAGCTATCACTGTTGCCGCTGCCAGCACCACGACCACCGCCACTGCCGATACCTCGTCGCCTAC
CCGCAAACGCAAGTTTGAGCTCGACGACGGCGATCTGCAGCGCGTCGTCGATGAGGACCGCGCGCGTGCTCGTCGTGCCA
TTGAGGCCGATCGTGTTGCTGCCAGAGATGCCTCGGCGCTGCCGTCATTCTGGGCCCCGTCCGAGACCCCGTCGTCCAAC
CGAGGCGTCGTCATCGGCTCGACATCAGCCAACGGCACCACCAACACCACCACAGCCTGTCCCGCATCCAACGATGGTCA
CGCCCTCTCTCTGCGCACGCTCGTGTCGCTGCAGTTCGCCGAGGACGACGCCGGCCGTCGCATCTGTCCAGCCTGCAAGC
GCTCGCTGTCCAATGCGTCACGTGCCGTCATGGCTAAACCGTGTGGTCACGTGCTCTGCCGCAGCTGCGTGCACCAGTTC
GTGCGGCCGATAGAGGGCGGCAGTGGTGCCGGTGCCGGTGCCGGCATGCTGCTGCACGATCCCCACGCACCCGAGGACGA
GGCCGGCGTGGTGCGCTGCTACGTCTGTGAGGCCGACCTGACCGAGGAGGCCGAGGGCAAGAAGCGCAAAAAGGACCGCA
AGGACAGGCACAAGAAGGAAAAAGAACGCGTCCGGCCTGGGCTCGTCGAGCTGCGCAGCGAGGGCACCGGCTTCTCGGCC
GGCGGTGCTAGCGAGGTCAAGAAGAACGCTGTGGCGTTTCAGTGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62