GenePrediction:GLEAN_3255 Details

Name: GLEAN_3255
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:185787..186180 (+ strand)
Length: 394
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:185787..186077 (+ strand)
Length: 291
Type: CDS
Source: GLEAN
Position: GCSC_89:186142..186180 (+ strand)
Length: 39
>GLEAN_3255 class=GenePrediction position=GCSC_89:185787..186180 (+ strand)
ATGTCTCGCCATCACCCCGATCTCGTCATGTGCCGGAAGCAGCCAGGCATTGCCATCGGCCGGCTATGCGACAAGTGCGA
TGGAAAGTGCCCCGTCTGCGACTCGTACGTGCGGCCGACAACGCTTGTGCGGATCTGTGACGAGTGCAGCTTCGGCAACT
ACCAGAACAAGTGCGTTGTGTGTGGTGGCGAGGGCATTTCGGACGCCTTTTACTGCTTTGAGTGCACACGGCTGGAAAAG
GACCGGGACGGGTGTCCCAAGATTATAAACCTGGGCAGTTCAAGGACAGATGTAAGTGTTTCCGCTCCAGACAGAGGGTC
GAAGATAAACAGGCTGCATGCTAACAAACCAACAGCTCTTCTACCAAAAGAAAACAAATCGGACGCAATACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62