GenePrediction:GLEAN_3256 Details

Name: GLEAN_3256
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:189383..192278 (+ strand)
Length: 2896
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:189383..189533 (+ strand)
Length: 151
Type: CDS
Source: GLEAN
Position: GCSC_89:189610..192278 (+ strand)
Length: 2669
>GLEAN_3256 class=GenePrediction position=GCSC_89:189383..192278 (+ strand)
ATGGCGCCGGTCGACACCCTGGCTGCGGCCGGGTCCAGCTCCTACTCGTCGAACACACTCGAGGTCGGCGACGGGACCTG
GGACTATACCAAGAATGATTTTCTGCTGCCCAATCTCGAGGGCCTCAACTTTGCAACGATGCGCTACAATGGTGGGTCCA
GCTGCATTCCTCTTCTTGACAGCGTGGTGGTGACGTGAACTGACCGAGACGTCGTTCTCCTTGACAGGAATGGGCAACCG
GTTCTCCAGCATCGCACAGTACCATTCGCTAGTGACGGGCCATGCGGTCATGGGAGCCATCACGTTCCTGGTACTCATCC
CGATCAGCGTGATGATTGCGCGGTTCAGCCGAAGCCGGTCGGGCCATGCGATACGCTACCACACGTACCTCAACGTGGTG
GCGGCCATGTTCTCGACGGTGGTGTTGATCCTCGGCTGGTTTGCCGTCGGTCCCCGCCGCAGCCTCAGCAACCCGCATCA
CGGCATCGGGATCGCCATCTACACGCTGATCATGGTGCAGACGATTGGCGGCCGACTCGTTCGCCACCTTGCCGGGCGCC
ACTCGCTGCGTCTAAATCTGCACCGCTGGACTGGCCGTGCCGTTGCCCTGCTGGGCATCGTGCAGGTGCCGCTGGGCCTG
ACGCTGTACGGCTCGCCCAAGGTGCTCTTCATTCTGTTCGCCATCTGGATGGCCTTTTTGCTGCTGGTCTACTTTGTTCT
CAGCCACCGCCAGGGTGGTAGCTACCGTTCCGGCTCGTACCACAGCAGCAGACGGTCGTCAGGGCGCAAGTCGACGGTGG
TCGGAGGCAGTAGCGCCGGTGGTAGCAGCGGTGGCGGCATGATGCGCTGGATAGCGCCTCTGGCGGCCGGAGCAGGGGCG
TGGGCGCTCTTTCGAGGCCGGAACAAGGCACGATCTCGCAGCCGGTCGCGTGTGGACAGTCGATCCCGTGCGGACAGCCG
GAGTCGCAGCCGGAGTCGCAGCCGCAGCTTCAGTCGCAGTCGAACGGACATGATGTCGTCACACCGAGGCTCAGAGAGCT
TTGTGGAGGACGAAAAGTACCGCAACAAGAAGCCAGCGGGCGGTGGGTTCATGAGCAAGATGATGGCGGCCGGAGCAGCC
GGCGGGGCGGGTGCACTTTTCAGCAATCTGCTATCGAAGCGCAAGGACCGCAACCGGGACGAGGAGTACTCGGCCGTGGA
AACGGACACGCCTAGCCGATACGGCCGCAACAGCCAGGTGAGCCGGGCGCAGCGCCCACCACCGCGACGACAGCCGATAC
CCCAGAGCGAGATCAGCAGCTACTTTACGGAAGACGAGAGCAGTCGACTGCCGGCGCGGACAACATCGCCGACGCCGGCC
TCTCGCCGTGGCCACGGTGTGGGCAAAGCAGTTGCAGTAGGAGCAGCGGCCGGAGCCGCAGCAGGGGCAGCAAGCTCGTC
CCGACGCAACAATGACTATGACGGCAGCAGCATCAGCAGGCCGGTGACGCCGCCGCGGCCGTCACACCAGCGGCATCAGT
CGGTGCAGGACAACGACGACGTATCGGACGACTCGCCGTACCAAAGCCCGTCGCAACGGACGCCAGCGGCGACGAGACCG
GGCAACACGGCAAAGACAGGAATGTTTGGCGGGATGGGGCTCGGGTGGATCGCGAATAAGATTCGGGGAGGCCGGACGGC
AGCAGAGGACGAGGATGACGGGCGATTGGGAGGACAAGGCAATCCGACGCCGTTGCGACGGGACCGGCGGTCGGAGACGG
GAGGAAGCGGACGACCACCGACACGGATGCAGTCGATGTCAGACATGACGGACTCGGTGTTGGATCCAGTGAGCTCGCTG
GCACCAGCGGCACCAGTGATTCCCGGCCAGGGGACGTCGAACCCGCGGCGGTCGGGACAGGTGTCGATGCCGGCGATGCC
GGACTCGGATGTGTCGTCTGTCCTGCCGACGGTCCTGCCACAGCGACAGCGACGAGACTCGCAGGGGCAGGGAGAGAGCA
GCCGACGAGCAGAGCGAGAACGAGAACGAGAACGAGAACGAGAACAGGAGCGACGACCAACGAATTCGGGTGGCGGCAGC
AGCAGCAACAACCCGGTGAGCGTGCGGCTGCGGGTGCATGACGACCGTGGCGGCAACGTCACTTTGCGGCGGTTGACGGA
TGAGGAGGCCGCAGCAGAGCGCGCAGGCGGTGGCAGCCAGCAGCAGTTTCAACCGGCGCCATCGCAGCTGCACTCACAGC
CATCACAGCCGTCCCAGCGGTCGCAGCAGCCGCGACGACGATACGACGACTCGGCGAGCAGCCTGTCAGAGGTGGACTCG
CCAAGCACACGACGATACCGACGCGACTCAAACGGCATTCGGAGGGCAGAGCAGTCAGCTGAGCGGCGGACGACAGAGGC
CCAGCAACAGATGCAGTCGCCGCCCCAGCTGCAGCTGACTAATCCGTCCGAGAGCACGGTGCACGCGCCATTGGATCCCC
CGAATCCACCGTTTGCAGGTGGCCGGCGGCCCAAGGACTCGACGTACTATTCGGGCGGGGCTGCAGCCGGTCGCGGTGGT
GGCGGCGAGAGCCACGACGAGCACGAGGCCGAGAGCAGTGTCGGCGCTGCAGGACCATCGAACAACAACAACATGATGCA
CCCGGCAGGACCAGATCAAGGCACGCTGTCCAGCATAGTCAGCCAGGACACACACGGGACGTGGAGCGCCATGAGTCCGT
CGCCACGGGGACGACGTGCAGCCGCTCGTCCGGGGTCGAGCGGGCGGCAGGGCAGTGATGGCGCAAGCACGCTGGCGCCA
GACCTCTCGGGACCATCAGCAGCCGAACGGCGGCGGAGAAGGCGGCTGGAGAGAAGCGAGACGAGCAGACAGCCGTCGCG
GGTGGACTACCAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62