GenePrediction:GLEAN_3258 Details

Name: GLEAN_3258
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:200561..206396 (+ strand)
Length: 5836
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:200561..200632 (+ strand)
Length: 72
Type: CDS
Source: GLEAN
Position: GCSC_89:201084..201493 (+ strand)
Length: 410
Type: CDS
Source: GLEAN
Position: GCSC_89:201557..201627 (+ strand)
Length: 71
Type: CDS
Source: GLEAN
Position: GCSC_89:203356..203390 (+ strand)
Length: 35
Type: CDS
Source: GLEAN
Position: GCSC_89:204404..205165 (+ strand)
Length: 762
Type: CDS
Source: GLEAN
Position: GCSC_89:205232..205372 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_89:205437..206396 (+ strand)
Length: 960
>GLEAN_3258 class=GenePrediction position=GCSC_89:200561..206396 (+ strand)
ATGGTCCCAGGTCTACCCCTCCTACAAGCTGAAGCGGCCAGGCATGATAGAGGCTTGTCAGCCCGCATAATAGTATGTTG
CATCAGAACGAGAACAGGAACCCTAATGCCTTGGCCCAAGCCCCTATTTATCATAGCTTAGATCAATTGAGCCATGCCAA
GAAAATCAGACGGACCGATACAAAATTTGGGGGGTTCGAATTTGGTGATTATAACCGACTGGTAGTAGATTTATACAGTC
GTTCGTCCTGTACTGATTTGGCATCAATAGAGCACTTGCCATAGGACGGCGTGTAGAAAGGTACAATGTCCGTTCGCCAA
CTCGCCGATAGGAGTCTCATCTAAAGACGTGCCAGCCTCCGTTGGCCATATAAAAGCATGTTACCCCCAGACATACGCGG
GCGACCGTCTCTTGTCTTCGATTCAGGTATCTTATAACCTAGCCTGTGTGCCGTTCTTTTCTCTTCTGCGGGCGTGTTCA
TCCGTGCTCCCCTTCCCTAATAACCGATACTGTTGCTCATCAGCTCCATGCATTCGTCCCGGTTCTGACTTGCCTTCTCC
TACGATGGCGAGCATCACTTGCTATAACCTCCCCCACCGTGCGACTTCTGTATGCCGACGCGCTGACCGACACCTTCTTT
GTCGGCTGCATAATTTTTGCGCTGCTGCTGCTGCTGCTCGCCGGCGCTGGAATATTCTCAGGAACACAGGCGACGGAAGC
TAGCACTGTCACCAAGCTCAAGAAAGGCATGGATATTGCGTTCGCAGGCGTCAGCACGAAGATCGGTGCTTTCTGCCTCT
TTTCCATCCCAGCCATTCGTTTCCGCTCCGTGAAAGGCAACAAGCTCTTCACCATCGATATCAGCCAGTATCAGTTTGAG
TCCCGCTGGCGGATGCTGCTGTATGTTATCAACGTCTTGTACTGCATTATCATGTGAGCTGTGCCGACCCTAAGTTCCGT
CCTATGTGGGGTGCCTGACCTTGTGGCTTCTGACAGATCTGGTCTACCTACCGAGAAGCCGAAGTTGCCCTCGGCAAAAG
ACAGTGTGCCGAGAAGCACGACTGGTGGTACGTTCTTAGGCACTCGAACACGCTGCCCTTATCGTCCGATAGACGACTAG
TCTACTGGACCGCTGACCTTCGTTCTTGTGACTACTAATCATCGTCTGTAGCTAGTACGTACTATATGCTATGTCGATGG
TCGTGGTGGTTTTCGTGTATACAATCGTTCCACTCGGTGCTCATGTACCCGTGGGTTTCCGCCATCAGTCTAAACACGAA
CGCAGGCACATTGCGCTACAGTATAACACAAGGGCCTACCGATGGACCAGATACTGCCGAAGCATTGATATCCATATTCA
GAAAAGGGGTTTGGCTAGATAGAATAACAATTTTTCTTGAGGGTTGCTTTTTGTACGATATATTAGATTTTTCATAAGCT
TTTCATGCACGTTACCTACAACCACCTACTTGATACTGTACCAGCCATCATTGTTCAAGTAACACTTACTATAGGACTAA
CACGCAACTCCGCGTGCCTAAATAGGGTGCAGCAAGTGCTAGAAGGCAGAGAAGAAAGACGCTGTTATAGCAACGGTGCT
CTGAATTCAACGGTGTAGTTACTGAGACACTGCCTAAAAGGGCGATACGCAGAACCTCACTTGTAATCAGTTATCCTCCT
TTGATTTATGCCCTCTGCTTGAACGGTTCATACACATTTTATTACTCGACCAACCCTTCTGTACCCTCTCCATCCTGTCA
CTTCTTCTAGTCTACCGGCGCCGTGCCTATCAAGTCCGCCTCTTCCTCATCATCATTATCAACCTCCACGTTAATTGCCT
CCAGTCAACTGCTTCGAGTTGCCAGCTGCATGTCCACACCCCTAGGGCGGCTGCGCAACTTTGCCGGCGGTGGTTCTCGG
GAGACGAGCTTTCCCCGTGCTTGGAACCGGTAGATGTGCCGGTGGTCCCAGACTGTGGTAAGCTCTGCCTTTGTACCTTA
CGTGCCTTCTTTCAGTTTGCACAATCTCAACAACCTTCAGGTATACCAGAGAAAGAACCGTGAAAATAGCTATCCCCTAC
GAATTTATGTCGCTTTGATCATAAAACTCCGATCATACTAGAGACCTCGTCTACTTACGGTGTATTTCTGCTCAGGCCTA
TAACCCTAAATGACTCAATCGCTGCTCCTGTCGATCAGGGATCATGCAAGAGCGGAGCTCCGGAGGGGTAGAAGATACTT
ACTCCGTACATGGCAGAGGCGTGAAGAAAAGCAAAACTGACCACTTTTTCCGTCCATATCCCAGAAGCCACCTTCCATAG
GCTAAGAATGAGACTGAGAGAGCGGTGGAATGGACGTGTCGCAATCCGACCCACATTCGGTATAAGCCGTGCAAGCTACG
AAGTATGGCACATCGTCTCACAAGCGACGTCGCAGTAGGGAGGGCGTGCGTGATTTGGTCGTTAATGCTGTACTCGGTAC
TCGTTAGGGCTCCCGCAGCTTAGGAGGTTCATCCAATAACCACAACGGCTAGATGCCCGTCCCGGACATACATCAAACAG
GGCTGATCAATCCTTGCACCTTGCCAAGGCCGTATGAGCACTCCGTAGATGGATTTAAAATAAAGAAGGCCGGTGCTAAA
TTAATAATGGGCGTCCCGATGCGGGTATGATTGGCTTAGTGGGGATTACTGTTAGGTCAGCAACAGGCAAGAGTTAAGAA
AAATCGAAAGATGGTCAATGCATTATTGGCAGTCGTTGCTTTGTATAAGCAAGCTGTTGCTGGCTCACTTTGTAGCTTTT
TCGGACTTGCGGGAGCAGAAAACGAAGGCAGTATGATACAGAAAGGTCCGTTGGTAAGAGACTTTTGTCGATGGCAGAAA
CTCTTATAGATGGCCGGAGAGTATAACGAATCGGACGATACTTGTTCAACACCAGGAACCAAATTAGGCTCTAATTCTAG
GGCCACTTCTGCCAATGCCCCCAGTTTTCAGTCCACTTTTTAGGGTGGACTACCTAATTACGACGTATAGCGAGAGGTGC
TCCTGCTTCTGTACATAGTACGAGTACTCTTGGGTCAGCACTTGTAATTCGTACTCGTAATTTTCCTACTTAGATCTGAT
CCTCCAACGATCTGGTTTCCCTTTTCGACAGTTCTTTTTCCTCTCTCCCCCCATAAACGCCTCTCTTCCCGGCTTCCGTC
CGGCACACAGCTTCGGAAGCACTGCCGTACCTTCACGCGAAACGCCAACAGCATTGCCCCTACTAACGTCTAAAAAAGAG
GATCCCTGATACCCTAGTCCACACTGACGACAATACGACTCGTGACCGTTTCAGTGGTCGGCTAAAGCAGCCAACGATCT
GAATTCCTAAAACAGACAAGAGAAGACATATCCCGACGACAGAAGCGAGGCAGCCGGCACTGGCACATCCTCCCCCCCTC
CCACCGCATCCACTTTGTCTGTCACCCATGGTCGAAGCGAATCAGTAACGCTTCCCACCCTCCACTGCTCCCTCTTGTAG
CTCCCCTCTCTTCGAAGCCTACGGAGGACGGAGCACGGCCGCACGTCATGGTTTTTTGTGGCAAGGCGTCTCTTAGCTGC
AAGAATTGTCGCATAAGACGAATCAAGGTGCGTGCCCTTGTAGGCTTTATGTCCGGTCTATATCGTATTCCATATTGGTC
TGGCGTGGCTCGCTTTTCTCCACGCTCCCCGGCTAGGCTATGGCATGCAGCGTGGCCAGCCCGGGTCCCCTCCATTCCTC
TCCGGCCTAACCCCTGCAGTGGGCCTGTTTAACGATCAGCAAGATTGCTGACGTGGCTGCGCCTCTGCTTCTCTCTCTAT
CAGTGCAACAAGCTACAGCCCGAATGTTCGCAATGCACGCGGGCTGGCAAGAAGTGCCCCGGCTACCGAGACCAGCTGTC
GCTGATGTTCCGGGACGAGACGGTCAAAGTGCGGAGCAAGTTCCAAGAGATTCATCCTCGCGGCGGCCCGGCGACCGCGT
CGTCCTCAGCTTCCACGTCAGTGGCCAGCACCAAAGATGCGAATGCCCTGCTAGTCACTCCGGAGGCATCTTCCTCTGGC
ACACTGGGACGGTGGCCAAGAACCACGTCTCGCAGCGGGTCCAACCAGGTTGACAGGCCCTTGGTCAAGGAAGAAGACGG
AGACGACAGAACAGACGAGAGGGCCATAGCATGGTTAGTGGAGACAAACAGGGAGAGCAGGCGCCTGTCCCAGACGCCGG
ATAACCTCGCGATTGTATCGGGCCGCAAGCCCTGTCCTCTGGCGGTGGGACCGCAGACAACGATGGCCGAGCGCGGGCTG
CATTTTTACATTGGCAGCTACATGTACGGACAGGCGCATGAGCCATCAGACTCGGCGCTGCTCGCGATCGAGTACCCATG
GCTGTTCCAGCCAGCGACGACTTCGCTCGTGTCGGCTGTAGGCCTCGTGGCTATGGCTAACCTGACTGGCGACAAGGAGC
TACGGGACGTGTCGAGACAGCACTACCTGTCTGGACTGCGGCAGACGAACCAGTCGCTGATGAGCGCGCGGCTGCAGGAT
ATGGAGACAACGATACGTGGCATTGTACTAATGGCCATGTTCGAGGTGAGCTAACGGGCATGGGGATGCTGAAGTTGAGG
GATCCGACCTGTGCTGACCGATTCTATACAGGTCGTCCGGGGCGACAATGAGTCGTTTGATATTGCCAGCGTACATGTCA
AGGGCGCCGCAGCGCTTATGCGCAACTTCCTGCCGCTGCTACCACCGGCGGCACAGCCGTTCCGGAGTCTGATGCAGTAT
TGCTTTTCCTTGGTACGAATTATACGGGGCGCCGCTCTGAAACCCCCTCTGGATCGCATTTCGCTCACTCTTCTAGCTAA
TTCCATGCTATGCGACGGGAGCTCGCATGCCACCAGTTGTCCTCGACTACGTCACGGCTGGGTCGCGCAACGTACCGGCG
AATGAGCGAGCGATCACAGAGCTGTTGGTGGTGGCGGCTGGCTTCGTCAATCTGTCGGCGCACGTGAGGAGTCACGTGAT
TGCAGATAATATGGCATCAACAACTACCTTGATAGCAAAGACACGACAGCTGGATGCACGGCTGTCTGCATGGGAGCGCA
GTGTACTTACGTCCAAGCAATGGCAAATGGAGTTGTGCCAGACGACGGTGCTGCCGCCAGATGCCTGTTTCGGCGGGCAT
TTCTACCGCTATGCCGACATGCCGACAGCCCGTATGTGGAGCTACTACAGATGGGTGCGGATCCTGAATAGCGAGCTGCT
GCTGGACATGGCGGAGAAATGTCCACAGTCAGCAGAGGCGGCGATGCGTGTGCCAGTGGGAACAGGGAGACCAGGAAGCT
CTGACATCGATGGCAACCAAGACGACCCAGACACAGGAGACAAGACCTTTGACTGCCTGCGGGCGCATCTCCTGCGGGTC
ATCCGCCGCATGGCCGAGGGGATTCTGGTCAGCACGCCCACATTCTGGCGACACCCGCGCGTGCCAAGAGAGGTCTACGA
CGCGCTGACAGCGCCGACAACGGTCCCGCCGCGCAAGGCCGGCGCCGGGGCGGTGGGTATGCCGCCATTGCTATTCCACC
TGCAGGCGGCTGGCTGTGGGCGTGGGGTGCCCGAAGCTCAGTGGCGATGGGCACTGGCCGTGGTCGAAATGGTGTGGGCG
AAGCTGGGCATGCAGCAAGCGCGGAAGATAGCTGACGCCATGAGGGCAAGCCGGCATGGCTGGCAGGGGATGCCCAAAAG
AGAAGGCCAATGGGACGTAGTCTCTCCTTTTGACTCACAATACATGCGGACATGTACCACAGGAGGTGTTGAATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62