GenePrediction:GLEAN_325 Details

Name: GLEAN_325
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1082153..1082807 (+ strand)
Length: 655
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1082153..1082200 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_167:1082311..1082449 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_167:1082515..1082562 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_167:1082650..1082807 (+ strand)
Length: 158
>GLEAN_325 class=GenePrediction position=GCSC_167:1082153..1082807 (+ strand)
ATGGGGAAGCGCAAGAAGAGTTCGCGCAAGCCTAACGGCCCAAAGAGGGTATGTCTTGTCTGAGGGTGACTCGTCATGGC
GACTGCCTCAGCCTTCTCGGCGGTTCCATCTGCGACCACTGCCACTTCTACATCCTGCTGACCTTGGACGTAAACTAGTC
CGACCCTTTGCCGACCGCATTTACCTGCCTCTTTTGCAACCACGAGAAGAGTGTAGCCGTCAAGCTGGACAAGAAGGTCG
GCATCGGCTATCTCGAGTGCAAGGTCTGCGGCCAGAAGTTCCAGTGCGATATCAACTGTACGTTACGACCGCTACGAGTC
GTGAGTCACCTGTTGTGCAATCTCCTACTGACCAGATTTCAGACTTATCCGCACCCGTGGATGTGTACGGCGAGTGGGTG
GATGCCGCCGGTTCGTTTCCCTTCCCTACCCCCCCCTCCCATCGCTTTTCCTTTCTTCAGTCCTTGTCTCCTCCGTCAAG
TCGCTGACTCTGTATAGATTCCGTTGCCAAGGTCGAGGGTGATAGCAGGCATGAACGGTTGAGCTCGGGCCGGTTGTCAA
GCAAGCCTTCACGAGGAGATGCCTACGATGACGACGACGGCGGCGACAGGCGCTATGACGGAGACGGCGTCGTGGGCGAC
GACGAGTATGACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62