GenePrediction:GLEAN_326 Details

Name: GLEAN_326
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1085218..1088046 (+ strand)
Length: 2829
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1085218..1087716 (+ strand)
Length: 2499
Type: CDS
Source: GLEAN
Position: GCSC_167:1087777..1088046 (+ strand)
Length: 270
>GLEAN_326 class=GenePrediction position=GCSC_167:1085218..1088046 (+ strand)
ATGCTATCCACGTGGAGCGACAAGAGCCAGCCTTCCAAGAAGAAGCTTGTGTCGTATGGGAAAGCCATGTCGCGATCACG
AAATCAACCGGCAAGTCTCTCTGCCTCCGCCCAAACCATCCCAGAATCGTCGCAAGCATCAGCGAAGGCCCCTGTGAAGG
ACATTTACGACTTCGACTATGTTGGCGACGACCCGCCGCCTGTCGCAAAGACACCAGCCCGGAAAAAGCCCACACAAGCA
GAGAGGGCGTCTACGAAGCCATCAGCAATTAGCAAGGCAACAGTTTTAGCAGTGCCGGCTACTCACTTATTGAAGCGTGC
TGCCGACCCCAAACATCCAGCAGTTGCCCGTCCTGTCGCAACACCAGCACCATTACCAGCACCAACAACGGCACGTGGAA
CAAAACGAAAGTCAATCCAAAGCGAATCGGCAGCTTGCCAACAGTCCAGTACTGGCATCAGCACCGCGAAGCCATTGCAG
TCTACTCCCAGTCCCGATCCAATCACCCTCGACTCGCCTCATTCTACTACCACCAGAGTTTCTAGGACTACCAAAAATCC
CCTCGTTCTCGGTAGCTCGTCACCTTCAGCCTCCCTGACGCATCAACGCTCGCTGAGAACACCCCCGCGAGACGCAGCGA
TATCAAGTGCTTCTAGGACCCTCGCGCAGTCCACGCCACCTAGCAAGGCTCGGGTCGCAGCCGAAATCGTCCGGCAGCAG
CGGCTTGTGCAGCCTTCATCGGGCGTGCCTTTCCGGTCTCAAGGTATCCAGTCATCACAGCCACAACAAGCACAACAAGC
ACAAACACGCCCAGCAGCGTTAGCACAGAGAAAGCGACGGAGGCTTATCGATACCCTTGCCGCCCAGAGAGAAGAGTCAG
AGTCAGATGGAGAGGATACAGACTCTAGAGATTTGGATATGGGGGACGACGAGGAGGCTAGCAGCCAAACATGCACCATT
GCCTCCAAATACCGGCACAGACGGAGCACGCCGGTCAGCGACAACCGGACGGCTTTCATGGACGTAGATAGCCTCGTGAC
GGCTTCGCCTGGGAGAATGCCCATTGCACCGTCAACACCAGGCACCTTAGCTCGTCGTCCGACAGCACGACGACCCAACA
TCAAATTCACATACAACGTGGAGAGAACAATGCTGGCTGAACAGCCGCCGGCTTTGGATGGTCCGTCAGGTAGCGACCTG
TCTGTTCTGCAGAGCCTCTTACCGGAGGCAGATCCGAAGCCCAGTGCTTTTGATTTCGACGACGATGCGAGCGGCCCTTC
ACAGGGTGCTATTCAGAGCATCCACGAGCTTCGACAGGCCGGGGCGAACAGCCGGTTTTCTGACGAGCTGGTCGATATTA
TGGACCGTATCGGAACTTCGGGTACCGGCAAGGCGTCGTCGACAAGGCGGTCTGCACTGCTGGAGATGGCAGGAAAGTTG
CAAGGCAAGTCATTCATGCGGCACTTTCGCGATCATGGCTCCGAGACGCAGCTCTTCCGCGATGTTGGAAAAGAGACTGA
TGTGGTTGCCGGATATGTCTTGGGATGCATCGTTATCACGCTTCTGGCAAACGGAACCGTGTCTGGTCGATTTTTGCGCG
ATTTGCGGACCCAAAAGATTGATCGTCTATTCGGCGTTCTTCTCCGCTTTGACGAGGACATTGTGAGGTTAGCCAAGGAC
CGGAAGAACAACGTTTCGGCCTTCTCTCGCCAGATACTCGGTACGCTGAAGGAGGCGATGCAGAAGCTACCGATCTGGAA
GCCGGCTCCGGCGGCCCCGTCCGACATGTCCCCGCGAACGGTTGCTCTGGTGGGCTTGCATTTGTTTGTGCAGCAGATTT
ACGGCGGTGGTGGCTTCGGCGACAACGATACCATATTGTCCTCATCCCTGACAAAACAACTGTTTGCCATCGTATCCTCC
ACTCTCCCGTCAGCATACGATAATGTAGACGGAGAAGACGAGGTTGAACAGGGTCCATCTGTTATGTCTCTCGGGTTTTC
TGGCAATGCAGAGACAGTTGATATGTACCTTGCTTTATCGTTGCTGGAAAGGCATTCGGTGGCTGCTATGCAGTCGGACA
TTGGTGCCGAGTGGACCCGCCATTATATTCCCATCGTTGCAGATGCATTGGAGGTAACGCTCGAGGAGAAACAGAGGTTA
GATCGTCAGTTGAACGGCTTAGAGCTGCTCGCCCTCAAACTCGCGATGAACACGGCCAACAACAACCCGGAAGCGGCACG
CCATTACGTGGACAAAGGCCACCTGCGAAGGCTAGCAGAACAGGGCAGCCGAGCGCTGGCAGGCATTGTTCGCTGTGTCA
AGACAGGTAGCGACGTCACCCCAGGCGCGTTGGATGAGCTGTTGTTGATGCTGGGTGTGATGATCAACTTCTCGGAGAAT
GACGAGACGGCGGCCGAATCGCTGGTCGAGGGCGGTGGCTCAGTGTTGATCGAGCGACTTGGAGCGTCCTTCCTTGACGG
TCGGTCTATTGCTGCTGAGGTATGTTGTTAGTATTGGAGGTGGTGTGAGAGACAGTGTACTGACCATGTTTGCGTGCAGG
CCGATTCGGAAGAAAAGACGCAGATCAATGTTGCGTTTGCATATCTTTCCATCCTTCTTGGGTATCTGTGTCGGTATAAT
CCAGTCTACAAGGCTTTCAAGCGGCTGTCCCCCAACGGCAGTCTCAAGCCGCTGCTGGACTCGATCCACCAGTTCATCGA
TTTCCATGATAAGGTGGGGAAGACAAGCGACGTGGACGGTGCAGAGGCAAGCCACTTCACAGCTCGACTTCAGGCGCTGG
CTCGTGAACTGGAACTGCGGGCTTATTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62