GenePrediction:GLEAN_3276 Details

Name: GLEAN_3276
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:305365..306777 (+ strand)
Length: 1413
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:305365..305434 (+ strand)
Length: 70
Type: CDS
Source: GLEAN
Position: GCSC_89:305507..306777 (+ strand)
Length: 1271
>GLEAN_3276 class=GenePrediction position=GCSC_89:305365..306777 (+ strand)
ATGTCTCACGAGCAAAGCCGCCTGCGGGGTAGCGCTACTGTCCACAAGCGGGCGCTAACGAGCAACACAAGTATGAGAGA
ATATTATGGGTTGTATGTGGATAACAGAGAATCAACTAACAAAGCTCTCCGTCGCTCTCTAGGACAAATCGCTTTAGCGA
AAGGGCGACGGTCGATCGGTAACCAGGGGGGAGTGATCGATCTGGATTGGTATCGGCCGTGGCTACGAGAACAGCGACGC
AAACATCCTGCGTTTCCCGACAACAGGAACGACAGGAATGACAGAAACCCCACGCATTTCGTCTTGGACGACGCCGACTT
TGACACGCTCGAATCGGCGATATTGAAGCACATCCGTACCACTCGTGGCCTAAGCATTGACGACGTTATTGAGCACCTTG
ACTGGGACAGCCTGGATCTGGACGCTTCGCAATCTGGCCCATCGACATACTTCAAGCGGTCGCTCATCTTCTCCATTCTC
GGGTGGCAATCGATGGTCTACCAGCCCGAGTTCAAGGTGTGCCCGGACAGCTCGCTCGCCATCTACCGCGCTGAGCCCGA
CTCGCGGCTCGTCTATGACACCTATACTGTGCCCGTCGACCTGTGCGACCGGCCGTTATACGTGCTGCTCAAGGGCTTTG
GAAATCTGCTACCGGCTCGGTCAAAAAGCAACAGCAACTCCGCCGCCGCTGTCGAGAGCAGCAAGGCGGTCGCGTCGTGG
ACGGCTCTGTATCCAGACCAGATGAACGCGTACCTGCTGCACTCGCTGTTGCGCTGCAAGTTCCGCTGGGTGGACACACT
GGCGCTGCACCTGGACTACGACAAGTCGACGCGAACGCTATCGCTCTTTTGCTTCCCCTCCATGTGCGCGTCGCAGCTAC
AGTGTAATCGCTGCGGTGCCATATTTGCCTTTGCTAGCACTGAGCTAGACGCGGCTGACCCGCGGGCTGACGAAAGCGAC
ATTGCCCACTTTCTTCAAGAGGTCTTGGCCTCGTTCAGGCTGCTATTTGGCCAGTCGGCCAAGTCACGCCGACTCTTCCG
CCTCGTGTACAACGAGAGCATGGCGCCGTTTGCACAGCCCGACAGTTTACTCCTACGGCTGTGCATGGATAAAAGACAGG
CCGGGACCACTGAGGGGGCCGCCGAGGCTGCCGCATGTCTACCACAGGACCGCCGAGTCTACTATGCGGCCCGCGACTTT
CCCGTCCTGTACGAACGCGTGGAGCTGCTAGCCAACGAGCTGAAGAGCGCCAAGCCCACAACGTTACGTGACCTGGTGCG
CGACCGCCGAGATACGCTGCAGTTCTGGACCTTTTGGCTCGTGACCATCTTTGGGGGCGCAAGCATCGTGCTAAGCATTG
TGCAAGCCGCCCTGGCGGTCATTCAGATTCTCCAGGCTGCGGGAAAGATCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62