GenePrediction:GLEAN_3277 Details

Name: GLEAN_3277
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:312754..315197 (+ strand)
Length: 2444
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:312754..313070 (+ strand)
Length: 317
Type: CDS
Source: GLEAN
Position: GCSC_89:313310..315197 (+ strand)
Length: 1888
>GLEAN_3277 class=GenePrediction position=GCSC_89:312754..315197 (+ strand)
ATGGGCGGCATGCATATCCACCGAGAGATTTTGTTTGACGACGGTAGCGTCTGGCTTGCCCGGATCCTGCGCGAGAACCA
CACGTCGTTTGACGACCGGCTAAGCAACCAGATTTTGCTAAGCGAGTGTGCCACGCTGCAATGGCTGCAAAGCGTAGACG
GCGTGCCTTCGCCTAGAGTGCACGGCTTCGGTCTGCGTGGTGATCGTCAGAACAATGAAGTGGGCGACGTGGCCTACATG
CTGATCGAGAAGTTGCCCGGACGGCCATTTGATACGCATATAGCGACGAAAGGGCAGCGAAACAAGGTTCTTAGCCAGTG
GGCCAACATCCTCTTTTCTCTTAGCAAACACCCCCTCGACAAAATCGGATCATTACAATTTGAATCCGAAGTGAAAAAAG
AAGCCACATCAGCATCACTTTCCACGAGTCCTCATACTATAAAAATCGGCTCTCTGGCCAGCGACCGGACAGGAACGCTG
CCTCCAATTGGCCCTTTTGACGACGCCTACAATTACTACAAGGCATGGGCTACAACATACCGAAATCTTGTCGCAGATGG
TCAGCTGTGCAACGCATATGGTCATTTCTGGCCGACAAGATGACCAGGACCGAAGACGGTTCTTCCTGGCTGTCTGATCG
CGGCTATAATGGCTTGCACACTGGTCCCTTTTTCCTCAAGCATTGCGACGATAAGGGCGACCACCTGCTGGTGGATGACG
ACTACCGCATCACTGGGGTCATCGACTGGACCTTTGCACGGGCAGTGCCCGCCTACGAAGCTTTTGGGCCCTCGCTCATA
TCGGCCGACATGGACAGCCTCTACTCGGGGCGCTTGGGTCTCAGCGGTGCGGACAGGCTGCTAGGCAAGGAGATGGCTAA
TAGCAATATCAAGTTCTCTTGCTTCTTCAAAAGCGACAAGATGCGGCGTTTCATCTTTGGTTTGGGCATGGGTCTTGGCA
TTTCCAGAGAGGAAGTACATAACCTGGCCAAGTGTCTGTTGAAGACTTTTGGACACGACGAAATGCCAGACTGGAGCACG
CTTCCTGCTCCCACTGCACGCTTTGCAACCTGTTCCGTCGGCGACTGCAACCGGCCTGGTGTTCGAGGACGCAGCTGTCC
AACCTGCTGTCAACATCTCTGTGCCGTTCACATCCTCCCGCTACGACACACATGCCCGTCGAGCAGAGACATGGACGACG
CCACCTGGGAAGCCAACCTCCAGGCCGAAATCGACTCTCTCCTAGCGCAGGTGAATGTCGCTGCACTCGAGCAACGGGCC
AGTCATCTCCGCGGTGGCATGACCTGCACCTTCATTCCAGGTAGTCGCCACTCTGGCGCTGGCGACGAAAACGCTCTCCT
CATGGGCTGTGCCAACTATCATGCACGCCTCCGCTTTGCCGACGGCGTCGAGTGGCTTGCTCGTATACCGCGGACAACAG
GCTTTGGTGACGTGCCCCTTCCATTGGTCGACTACTTGATCAGGAGCGAGTTCGCAACGCTGCACTTTCTTGAGACGATC
GGTCACGTGCCTGCTCCCCGAGCCTATGACTACGGGCTCTTCGGCGACCCTGCCAATACCATTGGTGTCGGTTACATTCT
AGAAGATGCCATTCCGGGACAGCCTTTTTATGCGAGCGAAGCGACGGCAGAGCAGAAGGCACATGTCTATGCTCAATATG
CTGAGATCTTGGCTCTTCTCAGCAAACATCCACAGCCACAGGCATGCTCTCTCGTTCCCAACGACGATGGTAAACGGGGC
GTGGAATGTGGTCCAATTGCGAGTGATCGGTTTCTGACTCTCGGGGAATACGGACCATTCGATAACTCGCTAGCCTACTT
CTCGTCGACAGCTGACCTCCGTCTCGACCTGATTGCCGACGGGCAGTTATTTCCAAAATACCCCAAGGAGGCATTTGTAT
TCTACCGTCTGTTACGTGATCGGATAGGACCAGTTCTTGCTTCTGAAACGTCTCCTTTGCCGCTGGGGTCCTTCTTTCTC
AAACATGTTGACGACAAGGGTGACCATGTGCTAGTCGACGACAACTATAATATTACCGCCGTGATCGACTGGCAATTTGC
TCGCTTCGTCCCAGCCTGTGAGGCCTTTGGGCCAAGCCTGTTCACGGCAGATCTGGGTTGTCTATATGGCGGCGAGGCTG
GCCTGAGCGCAGACGATGGTCTTTTTGCGGCCAGCTTTGCCAAGGCGGGACACCCCAAACTTGCCAAGATTGCGGGAGAG
AATGATTTGGCGAGGCGCTTCCACTTGGGGCTTGCGTCTGGAATGTCGAGGCAAGACGTTTTGAGACTGACGGAAGCGGT
GCTGTCACTACTTGGAGAGTCTGTCAACGATGTTGAAGAATGGATAGAGCAGGAATGGCATGTCTTGGCAGATACACGAC
GTGACAAGGCGGAAGCATTGACAAGAGACCAGAATACAGAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62