GenePrediction:GLEAN_3278 Details

Name: GLEAN_3278
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:338392..341132 (+ strand)
Length: 2741
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:338392..338522 (+ strand)
Length: 131
Type: CDS
Source: GLEAN
Position: GCSC_89:339224..340477 (+ strand)
Length: 1254
Type: CDS
Source: GLEAN
Position: GCSC_89:340800..340828 (+ strand)
Length: 29
Type: CDS
Source: GLEAN
Position: GCSC_89:340912..341132 (+ strand)
Length: 221
>GLEAN_3278 class=GenePrediction position=GCSC_89:338392..341132 (+ strand)
ATGACCAATCCCCAACCGGATGGCGCTCTTCTGCGCCCCAAAGCCGAAGAAATAGTGGCCTTGGGACTACCCAAACTCGT
CCTAGTACGGCACAAAGTCGCAGGAGCAGCCAAGCGAGTCCTCATCCGAGCGTGGGCTCTGTCGAAGGCAACAGATCAAG
CTTGCAGAATCCGACAGCTGTCAAGGTAGAGCTAACACCTACGCCACCAACAACGGGTAAAGGAAAGAAGCAGAACCATT
TGTTGGCTTCCTCTGCAGCAGTTCAGACACCGACCAAGTCAAGACGGGTTCGTACCGGTTGCCTCACATGCAGAGAGCGA
CATTTGAAATGTGATGAGAGTGTCCCTGATTGCCTAAACTGCCGCAAAGGTAGCCGGGAATGCAAGAGAGGTCTACGACT
GAACTTTGTCGATATTCAGACGAAACCAATCCCTTTCGTGCCACCTGTATCGGAATGGACTGGTGAGCTTACCCCGAGGC
AGACTAAAATTGTCGACACTGAAGCTTACTTTTCATTGACAGTTTCCTTCATCGACGAGTCTCGATTGATTGCTTCGGAA
TACGCCGGGGGCGTCAGTCGTTATCCCCCTTCCGATGAGGCGTTTATACATTTGCCTGAAGTGAAGGCTCGTGCATATCC
CGTCGCCAAACGCAGGCGCCTCTCCGGAAACACCAAAACCCCCGACAAACAAAATGGCGGCCACTGCGGATCAGCACTCG
CCGTTCCGAACCTGCCGTCATCCGCGAGCCTAGCTCGAGGACTGGTCGGTATAGATACGGTACCCCCTAGTGCATTGACT
CAAGAGAGAATACAAGCTCTACCGATCTCTAGCATTGGCATTAACGAAGAGGGCATCTTTGGTCTTGTGCCCATAAAAGA
AGAAACAAACGAGCGAGCAAGTGACTCTTTCGTCAGTGACTCGTCTAGCATTGCTTCGCCGGTGGTGCCCCAAATGAGAA
AGCCTTCATCTATCACGTCTTTCCGTGCAGAACTAGGAATCACCTCCGGGGGCGTTGTCTCGAGAAATAGGACCCCTCGT
GCCGGCACACGTCAACCTCGCAATGCTTTACCTGACACGCTACCCACACCTCCGTCCGAGAAGATACATGTTGGCAGAGA
GACTGGGATTGGCGTCGTCAAGTTTGGCAACGAATTCAGTGACAATATAGGCGAAAAAGAATATCTCAGCTCGCCGGATG
AGATCCTGTACATGCAAGTGTTCATGGAAAAAGTGGGAATCTGGATGGACTTGCTGGACAGAAATAAACACTTTAGCCGC
ATCATCCCGTTCTTGGCTCTCAAGTCGCCCATGCTACTCAACGCATTCTTGGCCTGCGGTGTCAAGCATCTGACATTGAC
GAACCAGGTCAGCAAGGATGGCAAGGCCCTACTCTACTACGATACGTCAACCACTCAGCTTTTACGCAACCTACAGAATC
CGGACAGAAATATGACAGAGTGTGCTACAACTGCTGTCGTTTTGAACGTCTACGAGATTATGAGCGAAGAGCCCAATGAC
CGGATGAGCCATATTGCTGGGGCACGCGCTCTGATTCGTGAGTGTGGCTGGAACGCTCAGAGCGAAGGAATTGGTGCCGC
TTGTTTTTGGCTCAACATTGGTATGGAGGTGCTCAGCTGTCTCTCTTTCAACTGGCCAACAGCATGGGACCCGAATCACT
GGGGGCTCGACCTTGGCTTCGTCGACGACTTCGTTGGCCGCAGTGACAAGAGGGCCATTGAAGCTTCGGCTCATAGGGGG
GATGGAAACAAAGACCAGCCGGACGACGAAAAACGAGTAGCTGAAGCACCAACAGACAATACTGGGGATTGTGCTGATGA
GGTGTGGACACACCGCATGTTTTACATTGTTGCGAAAATAGCCAACTTTCGAGCCAACATTCCTCGGTTTCAAGAGCCGT
CGCCCCATGTCGAGCAATTACGCCTACAGAATCGGTTTACCGAGTGGAAGCTTCTGAAAAGTCTTTGTGATGGTTGGAAT
CGCGAATGTCCGCGTTCCATGAAGCCGTTCGGTTATCTCTATCCAACACAGATCTCCCCTTCTGGATCGGTCTTCCCCAA
AGTCTGGTTAGTTGTACACGCTGCGCCCTTTCTTCTTAACCGGGTACTAATAGTCTGAAAAGGCTTGTCAGGCGAGCTGC
GGTGATCGGCCGCCTACTGTACCACACAGCTATGATATTGCTTCATCAAACCAACCCGATGAAACCTTCGGACTTGGGCG
CAAATCAAACGGCCCAGATACATCATGCGCACCAAGTATGCGGGATCGTGGCTCACACAAAAGACGGTGGTGTAATCAGT
GTGGCCTTTCGCAGTCTCGTCATAGCTGCACATGTCTTGCGAAACCGCCGCGAACAGGACGAAGTGACTACACTCTTCAA
CAAAATAGCCACAGAAACAGGCTTGCGCACTGTGAAAGTATACCAAGAACTGCTCCATGCTTGGAAGCGTGACAATGACG
TGTGGGGCGTTGCATCCTCTGCATCTCCCTCTGATTTCAGGTCGCCTCTTGCAGAAGTACCCGCAAGCGGTGTTCTTGGA
AATGGCTTTAGAAGAAGGTCTGCGCTCAGCTCTGGGCCAGAATCCAGTCCTACGGCCATCACTGGTCTCAGCCTATACCT
TTCTGGAGCACAACCAATCTATCGAGAATATCCTGGCCCAAGTGTCGGTGCTTCAACCACAGCCAGACATTTCGTTCGAG
CGCCAGGAAGCTCTGCAATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62