GenePrediction:GLEAN_3279 Details

Name: GLEAN_3279
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:343126..344183 (+ strand)
Length: 1058
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:343126..343305 (+ strand)
Length: 180
Type: CDS
Source: GLEAN
Position: GCSC_89:343431..344183 (+ strand)
Length: 753
>GLEAN_3279 class=GenePrediction position=GCSC_89:343126..344183 (+ strand)
ATGTCTGGGCTCTCTGGAACCGCCAACGGGCCTCATGCAGCAGTAGCAGCCGGGGAAGAGAAGAGGGCAGACGAAGGCGG
GGCGAATCCGACGATGAAAACTGGCCGTGATGATGAAGATACAGCAGCAGGCAACGAGACGGAGGACGAGCCAACCGGCC
TCTCTCCTGAGCAGGAAGCAGTAAGATTGGTGTCTCGTTTGTTTGATTTTTTTTTCCTTTCATTCTACTGTTTTTCTTCT
TTCTCGTCTCTCTCTCTCGTTTCACTCCCCTTGTCTTTTACGTCTTGCTGATGTGACTGTGCCAGGAGCTGCTGGCTGCA
GCGAATGCCCACAAGGCCGAAGCCAATGCGCACTTTGGCCATGGCCGGACCGACGCCGCCCTGACGGCGTACGAGGCAGC
AGCGGCGGTACTACCGGCGCACCACGACTACGACCTGGCGGTGCTACGGTCCAACATGGCGGCCTGCCACCTGAAGATGG
AAGCATGGAAGGAGGCAGTGACAGCGGCGACGCAGGCGCTGGATGCACTGGAGCGTGAGAAGAGGGAGAAAGAAGGAGGA
GAAAAGGAGAAGGAGGAGAAAGAAGGAGACAAAAAAGAGGAGCCATCTGAGGACGAGGTGGAGGAAGAGATCATCAGTGC
CGGGGCCAGCAAGGCGGCGCCGATAGCCAAGGCGGCGTTGACACCAGCTCAAATGGCAGCTCGCGACCGCGAGCGTATCC
GAGCCAAGGTGCTGCTGCGGCGAGGACGCGCTCGCGCCATGCTGGGGGGCTGGTCGAACCTGTCGGGTGCCGAGGAGGAC
TACCGGGCGCTGGCAGCACTGGAGCCCGACAGCACGGCGCTAACGGCGGCCGACCGACGACTGATACAGACACAGCTGCG
GCAGTTGCCAGCTCGGACAAAGGCGGCACAGGAGGCTGAGATGGGCGAGATGTGGGGGAAGCTCAAGGAGCTCGGAAACG
GGATCCTTCGGCCGTTTGGCATGAGCACGGACAACTTCAAGATGGTCCGGGACGAGAAGACGGGCGGCTACAGCATGAAC
TTTCAGCAGGGATCGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62