GenePrediction:GLEAN_327 Details

Name: GLEAN_327
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1092452..1093083 (+ strand)
Length: 632
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1092452..1092506 (+ strand)
Length: 55
Type: CDS
Source: GLEAN
Position: GCSC_167:1092575..1093083 (+ strand)
Length: 509
>GLEAN_327 class=GenePrediction position=GCSC_167:1092452..1093083 (+ strand)
ATGCCCTCGCCGTCCAAGCAGAGGAAAATTGCCATTGTTGGCAGCCGCTCCGTCGGTACGTTTACGAGCATATATATACA
CAGTTTCACCCATTTCGCACTGACCACTGATTATCCGCTCTAGGCAAATCCTCTCTTGCAGTTCGTTATGTCGACGGCCA
CTTCATCGAGAGCTACTACCCGACGATCGAGAACACGTTCAGCAAAGAGATCAAGTACAAGGGCCAGGAGTTTGCGACCG
AAATCGTCGACACGGCTGGCCAGGACGAATACAGCATTCTGAACTCGAAGCATTTCATCGGCATCCATGGCTACATGCTC
GTCTACTCCGTCGCTTCCATGCAGTCCTACGAGATGATCCAGGTGATCCGTGACAAGATCCTCAACCACCTCGGCGTCGA
CTGGGTTCCGCTAGTCATTGTCGGCAACAAGAGCGACCTGCGTCCCGAGCAGCGCCAGGTTTCTCTCGATGACGGCCGCC
GCCTGGCCGAGAAATTTGACTGTGCCTGGACTGAGGCCAGTGCCCGCTTCGACACCAACGTGGCCCGCGCCTTTGAGCTG
CTAATCGGCCAGATCGAGAAGTCGCAGAACCCCAACGAGCCACAGGACGGCGGAAAGTGCACCGTGATGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62