GenePrediction:GLEAN_3283 Details

Name: GLEAN_3283
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:361412..364187 (+ strand)
Length: 2776
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:361412..361456 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_89:361581..361930 (+ strand)
Length: 350
Type: CDS
Source: GLEAN
Position: GCSC_89:361984..362059 (+ strand)
Length: 76
Type: CDS
Source: GLEAN
Position: GCSC_89:362122..362486 (+ strand)
Length: 365
Type: CDS
Source: GLEAN
Position: GCSC_89:362558..363730 (+ strand)
Length: 1173
Type: CDS
Source: GLEAN
Position: GCSC_89:363935..364187 (+ strand)
Length: 253
>GLEAN_3283 class=GenePrediction position=GCSC_89:361412..364187 (+ strand)
ATGTCGAGCTCACAAGGAGGTGGCGACTCCAAGCTGTTCGCTCGAGTATGTTCCCATCCTCTCCCTGCGACCGCATCTTC
GATTGCCCTTTCTCCTCCTCGTGTATGACGCACGGACAGACATTATACCCCCATGCTATCGTCATGCCCTTTCCCCTCAT
CTTGAACAGCAACTGTACTTTTGCTGTGTCCCCATTCCAGGCATCACACCACTATCGGCGTGCTGCCCACCGCCGTCCCC
AATTTTCGTGGCGCATCGTCTTCATGTTGCCGAAATGTTCATGGCATATATGCCTCCGGCAGATCACCTGTACTCACGAC
GAAAAACTTCACAGGGCAAGGTTGCCGAGCTGCGCCTCGAGCTGAACAGCGGCGGCAAGAAGGACAAGAACAATACAGCC
AAGAAGATCGCGCTCAAGAAGATCGTCGCCAATATGACCATGAGCAACAACGACATGGTTGCCCTCTTCCCCGACATCAT
CGGATGCATGCATATCCAAAGCATCGAGATCAAGAAGATGTGAGCGTCGCCTCGGTGCTGGTCTCCAAGACGATGAGCTA
ATGGCGTCCCAGGTGCTTCCTCTTCTTGGTAAACTACTCAAGAATGCGCCCTGAGATTGCGGTCAAGGCAATTCCCGTTC
TCGAGAATGTGTGTTGCGCTGCATGCCCTTCCTCCTTCATGACGATGCGCCACTAACATGGCATGCGCAGGATATGGAAA
ACGCCAGTCCGCTAGTTCGCGCTCTTGCGCTGCGCACAATGTCCTACGTTCATGTCCGGGAGTTTGTCGAGGCCACTGTA
CCGTTGGTCAAGGTGCTGCTAAAGGACGCGGACCCGTACGTGCGCAAAACAGCTGCTTTTTGCGTCGCCAAGCTCTACGA
CCACGACAAGGCGATGGTGGAAGGGTCAGACCTCATCGACCGGTTGAACACGCTGCTGCGTGACGACAACCCGACCGTTG
TGGCGAGTGCCCTCGCCAGTCTGATGGACATCTGGGAGCGAAGCGATGCCATCAAGCTCACTATCGACTATGGCAATGCA
TCCAAGATGGTGTCTATTCTCCCCGACTGCTCAGAGTAGGTCCTCGTCACGTCTGGCTGACTGATATTCTTCTCTTCCGC
TTCCATCCTGCTCACAGTGTCTGCAGATGGGGTCAAACCTACATTCTCGAGGCTCTGATGTCATACACGCCGCAGGAATC
CACCGAGGCGACGCTCCTCGCCGAACGCATCGCCCCACGGCTCTCGCACTCAAACTCAGCTGTGGTGCTTACGTGCATCC
GCGTCATCCTCTACCTCATGAACTACATTGCCGACCAGAAGCAGATCTCGGCGCTGTGCAGGAAGCTGTCGCCGCCGCTC
GTCACCCTTTTGGCTAAGGGCCCTGAGGTCCAGTACCTGGCTCTGCGCAATGCTCTGCTCATCCTGCAACGCCGGCCAGA
GGTGCTGCGAAACGACATCCGCGTGTTCTTCTGCAAATACAACGACCCGATCTACGTCAAGGTGACGAAGCTCGAGCTAA
TCTTCATGCTCGCCAGCGAGAAAAACATTGACGAGGTGCTCACGGAGCTCCGGGAGTACGCTACCGAGATCGACGTGCAC
TTTGTTCGCAAGGCCGTCCGTGCCATCGGCAAGCTTGCTATCAAGATCGAGCCGGCGGCCCGCCGCTGCATCAACCTGCT
GCTCGACCTCGTCGCCACCAAGGTCACATACATTGTGCAGGAGGCCACCGTCGTGATCCGCAACATCTTCCGCAAGTACC
CCAACCAGTACGAGTCCATTATCGGGACCCTCTGCGAGAACCTAGACTCGTTAGACGAGCCCGAGGCCAAGGCCGCGATG
GTGTGGGTCATTGGCCAGTACGCCAGCCGGATTGAGAACGCGGACGTGCTCTTGGAAGACTTTCTCTTCTCCTTTGCCGA
GGAGCCGGTCGAGGTGCAGCTGTCCCTGCTGACGGCCACGGTGAAGCTCTTCATCCAGCGTCCGACCAAAGGCCAGGAGC
TCGTTCCGCGCGTCCTCAAGTGGGCGACCGAGGAGACCGACAACCCAGACCTGCGCGACCGGGCATACATGTACTGGCGT
CTGCTCTCGACCGACATGGAGGCCGCCAAACAGGTTGTCATGGGCGAGAAGCCTTCCATCACGGCCGAGGCCGAGCGTCT
GGACCCGCAGACCCTGGAGGAGATGTGCCTCAACGTCGGCACCCTGGCTACCGTCTACCTCAAGCCCGTGCAGACCGTCT
TCCGCTCGGCCCGACCACGGCGCCTGCAGGACTCGCCTGCGCTGCAGCGGCAGCCCAGCTCGAACAAGGGCTCCGCGCTG
TCCATGGCCCTATCACCGGCCTCCCAGCAACAGCTCATCCAGCAGCAGCAACAGAAGCAGCAGCAGCAGCAACAACAGCA
ACAGCAACAACAAATCCTACAGCAGCAGCAGCAGATGCAGATGCAGATGCAGTATCAGCAGCAGATGTACCAGCAGCCGA
TGTCAGGGATGCCGGTCGACCTGCTGTACGACTCGAACAAGAGCCTTTCCATGCTGGGCAACGGCGGCCAGCCGTCTAAC
ATCGACCTGCTCAGCCGCGACGTGCAGGGCCAAAATGCCGGCGGCCAGGCCAACGGCAACGCCATCGAGGAGGCCGACAT
GTACTTTTCTCAGATGCGCATCCAGGAGCAGCCTGACGCGTTTGGCGGCGGCGGATATCTGGTCAACCAAAACGCACCGC
AGTCTGTGTTTCATCCATCACAAGGGGTGATGAACAACGGGGATCTGCTGTTGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62