GenePrediction:GLEAN_3287 Details

Name: GLEAN_3287
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:389618..392264 (+ strand)
Length: 2647
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:389618..389766 (+ strand)
Length: 149
Type: CDS
Source: GLEAN
Position: GCSC_89:390033..390638 (+ strand)
Length: 606
Type: CDS
Source: GLEAN
Position: GCSC_89:390700..391229 (+ strand)
Length: 530
Type: CDS
Source: GLEAN
Position: GCSC_89:391285..392264 (+ strand)
Length: 980
>GLEAN_3287 class=GenePrediction position=GCSC_89:389618..392264 (+ strand)
ATGAACACCACAGCACCTCCCCTTTCTGGCTCTGTGACCCGGCAGCGAACGTCTACGCTTCGACGCTCCTGTGAGGCCTG
CAGGACAGTTAAGGCCAAATGTATCATTGAGGTGGCAGAAGCCACGGACCAGTCCCGATGTTGCAAGAGGTGCGTTACAG
CTAGGCAACACACAGACCAGACTGCGGCTAAACTGAATACCCCCCTTGAAAAAATGCCGATCTCGATTACGGGGAACCAT
TGCAGCTGCTGACTTCGCATCCGGCAATTCGTATAGGTGTTTGAACCATGGAGTGAACTGTGTGTATGAGAATGCATTAG
CTCGACCAAAGAAGCTGAAATATTCGTCGTAAGTTGTTCCTTACATATACCAAGTGCTGCTACTTGAGCTGCGGGCTAAG
AGATGTTTGTACCAGTCGCACTCGGGTGAGGGATGTCGAAGAGAAGCTTGATGGCTTGATTGCCCTGATAGCTGCAAGGA
AGGCGACAGCTGCCCAGGATGCTGTCACTGCTCTGGAGCCTGTCCAGTTGGCATCGCCGCCAGACCTCCTTGCTTCTGCT
GCCGAAATGTTTTTTACGGCTCCCAAGACACAGCTGCCTCTATTTTCACAACCATTCTTTTATCCCTCGCCATCACCAGT
GAAATATACGGGTATCTCTTTGACCGATTTTCCGGAACGAACTATAACCCTCTCGACAGCCAACACTATGCCAGTTTCAC
TGAGCAACGATGTCATTAATCGAAATATCATCAAAGAAGAGAAGGCCCAATCACTTCTGTCAGAGTACACTGTGAACTGT
GAACAGCAGTTTCCCTTTGTACTCCTCCCACCGTTTGTGACTCTCAGCCACATGAGACGGGAGCGACCTTTTGTTCTCTT
GGCAGTACTCACTGTTGGTGCCGAGACTCATCTTCAGGCACGATTGGCCCTTGAATTTCGGAAAGGCCTTGCACAATCCT
TGATCGTAGAGTCTAAGACCGGTCTCGACCTGTTGCAAGGCTTGCTTATCTTCTGCACATGGTACGTGGACGTCCTAGGC
AAATACCTTTTCCGATTAGGCTCTTAACATAAATGTCTACAGGCACCATCTGTATTTCAAACCATCCAGCAGCCAGTTGT
ATCAGCTCTCGCAGATCGCTGTAACCATGGCCGTCGATCTAGATCTGGAAAACTCCCTATCAATATGCCAAGCAGATATT
TTGCCAAGAATGCGAGGCTCGGATTCTCAATCCTCGACAGGGAGTAAACGCAACCCGGCCATAGGCTACCGCGACGAAAT
CGAACGTGCACGCACCTTCATTGGAACCTATTGCATGTCAGCGAGCGTTGCCATAGCACGCCGGAAGCCAACTCACTTTA
AGTTTGACGATCGAGTTGATCGAGTATCTCAGATACTAGCGACCAGTAGAGAAGTACCGTCGGATGTACATCTTCTGCTA
CACCATGTGAACATTCGCAAGTTGACGGAGGACGTACATCGTGTCTTCAATATCAGCAACCCGAACGACAATGCAATCAT
GGACGAGAAATACATCGACACAATGGTCAAGGATTTTGAGCGCCAGTATGCGTGTATAAGGGACTCGATGTCGAGTGAGG
CCTGGGACAATGGTACGCTTCTATTCTATTCTCCGTCAGCGCCCGCTTTACTGATCTGTCGACCCAGCTTCCCTCAAATG
CGCCGTGACGTATTTGCCGGCTGTCATTTACGAAGTTGGCTTGAAGGTGCCGTCTAGTCACCGGCCCATCAGTCGATCAT
CGTCAGCTGCTCCATGCTGCAACTGGTGTATATCGCCGACCCGATTGGCCATTGTTATGAAATGCATTCACGCCACCCAA
AACTTTATCACCACCCTTCTCGAACTCCCGAATCCCGTCTTTAGGCATTGTACCACAGAGGAAGTAAGTCACCATCTCGA
TGCTGTCTTCCTTCTTGCGCGGGCAAGTATGGGACACGTGGGTATAGGAAAAGTCAACCTATTTGCAGCGGCCGATCTAG
AGCGGTATCTGGAAGCCTCGGAACAAAAGATGGCCTCAATGATGGCATTCACAATGTCCCATGATGGGACCGACGTTGCG
GAGAAAAACAAAGATGCTTTCTGGAAGCTGCGGGAGATTTACCAGTTCTGCCTTGCCTGGTATCGCGCCCATGTGCGCGA
CAAGCAAGATGCTGTCGATCTGAAAGACAGGTCCTGTCACGATGGCAAATCGAGTCAGCGAATGTCGTCCGCGTATCTGC
TCTCAAAAGAATTTGCTGTATCTGATAAAACTACGGTCAGGGACGGCCAGGATAAAGGATTCGTACAACATCCCGCACTG
GAGGCTCGATTAAACAAGGACGCGGAGAGCCTGCTGGTGGAACTCAACGTGTGTGAGAAGTCGATGGCTATGATCTCGGC
GTCATGTCCAGGACCAGTATCGACATCTACTTCTGGAGACGTATCTCTGTCCGATTCGGTGTCCCAATCAGAGTCGGCAA
CAGGATCAGGGCCTGGAACGGACTGGGAAGAAACCGAACCAGACTTTGACTCGGCGCTGGCAGACGGCTTTGGCATGGTT
CCCGATGTTTATGAGCCCACAGCCGACGCCGACCCTTGGAGTTCCATGATGCAGGCATCACCCCCATCGCCTTGGTTTAC
TTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62