GenePrediction:GLEAN_328 Details

Name: GLEAN_328
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1094059..1096824 (+ strand)
Length: 2766
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1094059..1094127 (+ strand)
Length: 69
Type: CDS
Source: GLEAN
Position: GCSC_167:1094193..1094275 (+ strand)
Length: 83
Type: CDS
Source: GLEAN
Position: GCSC_167:1094330..1094355 (+ strand)
Length: 26
Type: CDS
Source: GLEAN
Position: GCSC_167:1094422..1094743 (+ strand)
Length: 322
Type: CDS
Source: GLEAN
Position: GCSC_167:1094806..1094848 (+ strand)
Length: 43
Type: CDS
Source: GLEAN
Position: GCSC_167:1094913..1094920 (+ strand)
Length: 8
Type: CDS
Source: GLEAN
Position: GCSC_167:1094978..1094997 (+ strand)
Length: 20
Type: CDS
Source: GLEAN
Position: GCSC_167:1095051..1095111 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_167:1095181..1095225 (+ strand)
Length: 45
Type: CDS
Source: GLEAN
Position: GCSC_167:1095287..1095317 (+ strand)
Length: 31
Type: CDS
Source: GLEAN
Position: GCSC_167:1095366..1095399 (+ strand)
Length: 34
Type: CDS
Source: GLEAN
Position: GCSC_167:1095531..1095588 (+ strand)
Length: 58
Type: CDS
Source: GLEAN
Position: GCSC_167:1095646..1095678 (+ strand)
Length: 33
Type: CDS
Source: GLEAN
Position: GCSC_167:1095743..1095831 (+ strand)
Length: 89
Type: CDS
Source: GLEAN
Position: GCSC_167:1095901..1096042 (+ strand)
Length: 142
Type: CDS
Source: GLEAN
Position: GCSC_167:1096098..1096159 (+ strand)
Length: 62
Type: CDS
Source: GLEAN
Position: GCSC_167:1096217..1096267 (+ strand)
Length: 51
Type: CDS
Source: GLEAN
Position: GCSC_167:1096329..1096350 (+ strand)
Length: 22
Type: CDS
Source: GLEAN
Position: GCSC_167:1096411..1096448 (+ strand)
Length: 38
Type: CDS
Source: GLEAN
Position: GCSC_167:1096509..1096581 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_167:1096653..1096824 (+ strand)
Length: 172
>GLEAN_328 class=GenePrediction position=GCSC_167:1094059..1096824 (+ strand)
ATGCTTGACGTCCTCGATCTGATCGTCGAGCGCGGCGGCAACCCTGAGGCTGTCCGGGAAAGCCAGCGCGTGAGTGACTT
CCGCTTCTGCTCGTTTGCATAAGAGCCTCCGACCTTGCTGACACGCTGTGTCAGAGACGCTTTGCGCCCGTTGAGGTTGT
CGACCAGGTCATTGACTTGTGGCAGGACCACCGTCGCACTCTCTATGCGGCCACCCAGTACGTTCTATGCTCCAACAGGA
GAGAGAGTCCTGCGTGCTGACCGTGTCCCAGGCTGAATGCAAAGATCAACGAAATCCGTATGTGATCCTCCTCCTGAGCT
CGTAAGCTCCTTCCAAGATTTATGCCAACCTCTCCTCTTTCAGAAAAGCAAATCGGTGCCAAGAAGAAGGCCAAGGAGAA
TGCCGACGAGCTGCTCCAGCAGAAGATTGCTATCGAAAAGGAGAAGAAGGAGATCCTCGACTCGGCTGCCGCCAAGGAAA
AGATCATGAACAAAGCCCTCGCCACCATTGGCAACATCATCCACGACTCCGTCCCCGTCTCGGCAACAGAAGACGATAAC
CCGACCCTGCGCACCTGGGTGCCTGCCGACCGCGAAGTCCCCATCGGCCAGGAGGACCGCAGCACCTTGCTATCGCACCA
CGAGCTGCTGCTGCGCATCGATGGCTACAACCCGGAAGCGGGCGTGTGCGTGGCGACCACCTGTGTTCCCTTTGTATGGT
CGACTATCCAGGCTAATTCAGACGCAGTAAGGTGGTTGGACACCGAGGCTACTTCCTCAAGAACTGGGGTGTAAGTACCA
TTTCTCCAGGTGCTTCTATCGCCTGAGCTTTTCGTGCTGACATAATTGATTTAGGTTTTCCTGTAAGAACCGCGTTTGAT
GCTGCTTTGTTGTGAGAACTGCCAGCTTACTTTTGGCAGGAACCAAGCTATTATAAATTGTGAGTCTGCCTCCATACTCT
GTGTTCGGAGGTGATCACTGACCGAGTAACAGTCGGACTTGAGTTCCTCACGCAACAGCACGGCTACACGGCCCTGCAGT
CGCCTTTCATGATGTATGTGACTCTAAAATCCATTAGATCGACCGGCAATTCGGAGATATATCGCTAACATATTTCCTTC
AGGTCAAAGGAAGTCATGGCGCAAACAGCTCAGCTCGACGATTTCGAGTAAGCTTTCACTCCACAGTGTGGTTTGTAGAG
TCTAGTCCTGATGCTAACACGAGTGTAGCGAGCAACTATATAAGGCATGTCGACTTTTGGTGGGGGGAAGATTATCGTGG
AATGTTCTCTAACCATATGGTCTGCAGGTTGTTGATGGCGATTCGGAAAAGTACCTCATTGGTACGTTCTCGTTCTTACC
CCTTTGGACTCAGACTGTCAGCTAACCCTATTTCTAGCAAGTAAGTAGCGAGCTCGTGTTTAGCCACTGCGCGGATTCAT
GTAGCCCAACAACAGGCTGACGTCCAACGCAGCTTCCGAGCAGCCAATCTCGGCGTACCACGCCGGACAGTGGCTTCAGC
CCGCCGAGATGTGAGTTCACGTCGCACTGCTTTGGCGTATTGGCATTACTTGCTGACATTCATACAGGCCCATCAAATAC
GCTGGCTTCAGCACATGCTTGTAAGTCGGGGCTCACACCTGTCCCGCTTCTATATTGGCCATGTTACTGACAGACGGGTT
GCAGCCGTCGTGAGGCTGGCTCCCACGGCAAGGATGCCTGGGGTACCTTCCGTGTGCATCAGTTTGAGAAGGTCGAGCAG
TTCGTCCTGTGTGGTATGTCTTGTGTACCCATTGTTTCGCATATTGCTTTTGGAGGACAACATTTACTGACTAGCCATAC
AGATCCTGAGAAGAGTTGGGAGATGTTCGACGCAATGATTGCCAACTCCGAGGAGTTTTGCCAAGCTCTCGGCCTACCGT
ACCGTGTTATTGCCATTGTCAGCGGTGCCTTCAACCAGGCAGCCAGCAAGAAGTTCGATCTTGAGTAAGTTCTATCGTCA
TCTGGCGGTAGACCGGCCTGATACTGACATGCTGTATAGGGCTTGGTTTCCATACCAGGCAGAGTACAAAGAGCTTGTTT
CCTGCTCCAACTGCACCGATTGTGAGTGACTTCATTGATCTCAAGTGACACCGGAAAATAGACTTACACAACATGCAGTC
CAGTCTCGGGCTTTGGATATCCGGTACGGCGCAAAGACCCAGACCGATGGTATGCTTTACTCACTCCCCGTCCACACTGC
TTCCGAGACATCTTGCTGACACACTTACAGCCAAGAAGAAATACGTCCACTGGTAGGAATTACTGAACGCCTCCTACGCA
CCACGAGGCCCACCGCCACTAACGCGATCTAGTCTCAACTCGACCCTGACTGCCACTAGCCGGACAATGTGTAAGTGTGC
AGTCCGGTGAGACGGGCGAGATTGCAAGCATCAGGGCTAACAACTTCCAGGCGCTATCCTCGAGAACTTCCAGACCCCAG
AAGGTGTGCGCATTCCCGAGCCGCTTCGGAAATACCTCCCAGGGTAAGTGATTGCTGGCAGTACAGAGCAGAGAAGCTCT
CCCCTAGGAATACACGATACTGATGCCACAACAGAGCTCCCGATTTCCTGCCCTTCACGAAGGAGTTGCCAAAGGACTCC
ACTTCGCAGAAGGCCAAGGCCAAGAGCGACAAAGGCGGGGCTAAGCAGAAGGTTGCGGCTGCAGCTGGCGCTGCTAGCGA
CGCCGTCAACAAGGCGGCCGACAAGCTGAAGGATGTCACGGTGTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62