GenePrediction:GLEAN_3290 Details

Name: GLEAN_3290
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:400464..401147 (+ strand)
Length: 684
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:400464..400602 (+ strand)
Length: 139
Type: CDS
Source: GLEAN
Position: GCSC_89:400672..400994 (+ strand)
Length: 323
Type: CDS
Source: GLEAN
Position: GCSC_89:401094..401147 (+ strand)
Length: 54
>GLEAN_3290 class=GenePrediction position=GCSC_89:400464..401147 (+ strand)
ATGGCGCAGCATATGCTCCAGATTACGTCCGAGAGCGCCTCTGCGCCGCCTCAGGTGAAGCCGCATCTGCTGCCTTGCCG
GATTCACCACACTGGCCCTGTTGGCGCGACCGACCTGTTCTGGGCGCCGAAGACAGAGGGTGAGGCCACATGAGAGGGGG
CGCATAGAGGCGCACGGATAGGCTGCCGCTAACCCTTTTTTGGTCCAGGAACAAAACATACGGCCTACTTCCGCGGTCGC
AAGCTCTGCGGACACGCCGTCCACGTGCCCGAGGGATATCGCGGCGTTGTGGGCGCACGGCAGCCATCGGCACAGGAGCA
GGCACGGCAGCGGAACGAGCCCGAAGAAATTATCGACGTCGACGCAGATGTGGATGACCAGGCGGCACAACGCCAGCAGA
CGGTGACGGGTGGGCTGGCTGTGCTGGCCGAATTCGACGAGATGATCGTATGGGGACATCACAGCGCGCCGGACGCGGCA
ACGGATGCACACATGCGGGGAGTGGACGAGTGGCTGGCGCTGTCCGAACAGGTGAGACTAAGTTCCGAGAGTTCTTTTCG
TTTCTCATTACTTCAGAGGGCTTCTGCTGTTTTTCTGCTTCAGCTGTTTACTGACTCGATCGCCTTGCAGATACACTCCT
ACCCCAAAGATGAAGGTGATGGCACCGGGAAAGCTACAGGCTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62