GenePrediction:GLEAN_3291 Details

Name: GLEAN_3291
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:401554..404602 (+ strand)
Length: 3049
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:401554..401849 (+ strand)
Length: 296
Type: CDS
Source: GLEAN
Position: GCSC_89:401902..403462 (+ strand)
Length: 1561
Type: CDS
Source: GLEAN
Position: GCSC_89:403637..404602 (+ strand)
Length: 966
>GLEAN_3291 class=GenePrediction position=GCSC_89:401554..404602 (+ strand)
ATGGCTACGCCATCTAGCGATGTTGGCTACCCAATGTCAGACGGGTTTTCGCGAACACCCTCAGCAGCAGCGACCCCGCG
CCGCCGCGGCCAGCCCAACTTGCTCAGCTCATCGTCAGCCCGGCCACGGGGCCCACCGTCGGAAAGCATGGGTGCCCCAA
GCGATGACGAGGGCGAAGGCTTTGCCGATGATCAGGTGCCGCAGCGAGCAAGACGTGCCAACGACGATCCGGTGCCACGT
GTCGAGGACAAGATCGGTCTTGCGGTCCAGCACTACTTTGAGACGTTTATTGAAGAGTGCGTGGTCTGTTGTGTATATGT
CGTGATCTCCTGCTGACTCGTGCGGCAGATTCGTCGAAGAACCCTCTCCCTCAGGCGACGTTTCCTCCAGCGCGGCAGTG
ACAGACCGGTTTTACGTGGCGCAGATCCACGGTATGCGCACCTACCAGCTGTCGACCTTTTACGTCGACTTCCGGCACCT
GACGCTCTGGAACAATGGGGTGCTGTCGGAGGCGGCATTGCGCATGTACTTCCGGCTGCTGCCGTACCTCACGGCAGGGC
TGCACAACATGATTGCCAAGTACGAGCCGCAGTACTTCCGCGAGCACCGACAGCTGACATCGACGACGGCCAGCGGCAGC
GGCAGCGCGTCGTACGGCACGATGGCGGGGAGCAGCCACGCAGGGTCCTCGCAAGCGGCCGATCTGGGCAGCAAGACCAG
CAACCAGCAGACAGACAAGCTGTTCACAGTGGCGGTGTACAACATGCCGCTGGTGTCGCGAATTCGGTCGCTGCGGGCAA
CCAACATCGGACAGCTGCTCAGCATATCGGGCACGGTAACACGGACGTCAGAGGTGCGGCCGGAACTTTCGCTGGCCACG
TTCACGTGTCTGCCATGCAAGGCAGTAGTTCCCAACGTGGAGCAGGTATTCCGGTACACGGAGCCGACGCAGTGCCCAAA
TCCGACGTGCCAGAACCGCCAGGCATGGCAGCTAGACATCCGACAGAGCACGTTTGTGGACTGGCAGAAGGTGCGGATCC
AGGAGAACAGCAGCGAGATCCCGACAGGCAGCATGCCGCGGACGATGGACGTGATTCTGCGTGGCGAGATGGTGGATCGG
GCGAAGGCGGGCGAGAAGTGCATCTTCAACGGCATGCTTATGGTGGTGCCAGATGTGAGCCAGCTGGGGCTGCCAGGTGT
ACGGCCAACGGCAATCCGGGACGACCGCAGCGCGTCTCGGGCGGCCGGAGCAGACGCAGCAGGCGGCACGGGCATTTCAG
GCCTCAAGGCGCTGGGTGTGCGCGACCTGACATATCGGATGGCCTTTCTGGCCTGCATGGTGCTGCCGGACACGACGAAT
CTGGGCGGCAGCAGCAGTATCCCCAACGGGCCGGACACGACGGGGACGGACATTGTGGCAGCACTGACACAGACGAGCGG
ACGAGACGGTCCTGGCGGCGGTAGTGGAGGCGGAGGGGTCGGAGCGTTTGTGTCGTCGCGGGAGGCACAGGAAGCGGTGC
TGAGCGCGTACACAAAGACGGAGATTGACGATTTGCGCAAGATGGTGCACAGCGAGTACATTTACGCACGGTTGGTCAAG
TCGCTGGCGCCGATGGTATACGGGCACGAGATCGTCAAGAAGGGACTGCTACTGCAGATGGTGTCGGGAGTGCACAAAGC
GACAGCCGAGGGGATGCAATTGCGTGGCGACATCAACATCTGCATCGTGGGCGACCCGTCGACGTCCAAGTCGCAGTTTC
TCAAGTACGTGTGCAGCTTTGCGCCGCGGGCGGTCTACACGTCGGGCAAGGCGTCGTCGGCTGCCGGTCTGACGGCAGCC
GTGGTCAAGGACGAGGAGACGGGCGAGTTCACGATCGAGGCGGGTGCACTAATGCTGGCAGACAACGGGGTCTGCTGCAT
CGACGAGTTCGACAAGATGGATCTGGCCGACCAGGTGGCGATCCACGAGGCGATGGAGCAACAGACGATCTCGATCGCCA
AGGCAGGCATTCAGGCGACGCTCAACGCGCGGACGTCGATTCTGGCAGCAGCGAATCCGGTCGGCGGACGATACAACCGC
AAGGCGACGTTGCGGCAGAACATCAACATGTCAGCGCCGATCATGTCACGGTTCGACCTCTTCTTTGTCATCCTGGACGA
GTGCAACGAGAGCGTCGACCGGCGGCTAGCCGAGCACATTGTGGGCATCCACCAGCTGCGCGACGAGGCCATCACGCCCG
AATTCACGACCGAGCAGCTGCAGCGCTACATCCAGTTTGCCCGCACCTTCCAGCCTGAGATGACAGACGAGGCGAAGCAG
CTGCTGGTCGAGATGTACCGCGAGCTGCGGGCCGACGACGCCCAGGGTGGTGTGGGCCGCAACTCGTACCGCATCACCGT
GCGACAGCTGGAGAGCATGATCCGTCTGAGCGAGGCCATTGCCAAGACGAACTGCGTCGACGACATCACCCCGGAGATGG
TCACGGAGGCGTACAACCTGCTGCGTCAGAGCATCATCTCGGTCGAACACGACGACGTCGAGATGGAGATGGAGGAGGAA
CGGGGACAGGAAGCAGAGGCCACAGCAGAAGACGTACCAGAGGCCGTGCAAGAAGATGTAGCCATGGAGGGCGATGGCGA
AGAGGCTACAGCCACAGCCACAGCTACAGCTACAACCACCACAGCCACACCTTCCAAGGCCACCATCACCTACGACAAGT
ACGTCGCCATCGTCAACGCCATGGTGGAGCGGCTGCGCGACGACGAGGTGTCGGGACCTGGCGAGGGCGTGGCTGCCAGC
GCGCTGGCCGACGGCTTCCTTGAACAGCAGGAGGCCGAGCTCGAGACCGAGGCCGACTACCACCGCGAAAAGGCGCTGGT
GCTGATGGTGCTGAAGCGCATGATCAAGGAGAAGATCGTCATGGCCGTGCGCGGACAGGGCATCGCCGACGAGGGTGACG
CCACCGAGGGCACGGCCGGTCCGTCGTCAGCGTCGGCCCAGCAGCTGGTCTACGTGCTGCATCCCAACTGCTCGTTTGAG
GAGTACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62