GenePrediction:GLEAN_3292 Details

Name: GLEAN_3292
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:410526..415637 (+ strand)
Length: 5112
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:410526..414278 (+ strand)
Length: 3753
Type: CDS
Source: GLEAN
Position: GCSC_89:414327..415407 (+ strand)
Length: 1081
Type: CDS
Source: GLEAN
Position: GCSC_89:415498..415637 (+ strand)
Length: 140
>GLEAN_3292 class=GenePrediction position=GCSC_89:410526..415637 (+ strand)
ATGACCAAAGGCCTCAAGCCACGGGCTGGCTCCAGACCGGCAGACGATCCATCTCCGTCCTGGGGCTCCGTCTCCGAGAA
CACCACTCCAATGTTGAGCGCCACCGCCTCCAACAACCACTCGCTCTTCTCCTTTGGCCGCAACAATGGCTCCGACAACG
TGGCTGCCGCCTCCGGGAATCCCTCCACCAACAGCTCCGCCCACCATGGCGACGACTCGGCCGACCGATCCACCTTTGAT
TTCCTCCCGTCCGTCAGTTTCGACGATCTGCAGAGCAGCCTCGAGTCCGCCTCGCACGAGTTCAAGCTAGCCCAGTTTCC
CTTGCCCTCCGGCCAGGGCGCCATCCTGGACCCCAAGGCTGACCGTCCGGTCAAACCGGTCGTCTTTACGGCCGGAGGCC
CAGTCCCTTCTGCTGGCCCCGGCTCTTCCCGCATCGCTGGCCCCTCGTCAACCCCCATCTCGGCCGTGAACGTCCTGCCC
GCCGCTCGCAATGTGAGAGCAGGTATTCTGCGTCGTCCCAGCCTCACCAATCGCCAGAGCAGCATCCCGGCTTCTTCGTC
CGTCTCCGACACGACCTCGGCGGCCGTCGCCACGAGACAGCGTCGTCCGAGCCACTACCCCCCCGTCTCCAACAGCAACC
TCAGCAAGGCGCCAAGGAAGTCGGTCAATTCGGGCATCTTCGACCCCGAACAAGGATCGGGCCTGGCGCGGTCTTCATCG
CGTCGACGGCCAAGCGTGACGTCCATCTCGGACGGTCCAGCCTCTGGCTCGACCCGTTCGTCTCTGGATAGCAGCAACCG
CCTGAGTGGCAGCCTGACCGGCTCACGGACCACTACCGTGAAGCCTTTCCAATTCAGCGGTGGCGCCCCCAAGGCGTCCG
CTGCAAGCGGTAGCAGCCAGAACCAGAGCCAGAACCAGAGCCACCCTGCTAGAGCCATGGGGCCGACGTCTCGGGCACCA
CGGAGCAGCAATGGCCTGAGCAACAACAGCACGCCCATCCACAACAGCACCATCAGCGTCGGGTTCGGAAGCGCTTCCAA
GGGGTCGGCCAGTCAGCCATCGTCGGCGAAACGGGCGTCTGTTGCGCCTTCTGCCCTTCACGCAACCGGGCTGGGTGCAA
GGACTATCAGTCCTACCGATACCAGGAGGCTGAAGCGCATGTCCACTATGCCGCCCAGCAACAGCAGCAGCTTGACTGCC
AGTGGAAGCACCGGCGCCAGCGCCAGCGCCAGCGTCAGCGTCAGTGCCAGCACCACAACAAGTACGTTGAACATTGCCAG
CACCGCCAGTCGGGATACAGCCCAGCTGGCAGCCGTATCTCTGCCGCCATCGGGAGAGGTCCGGGCTTCGTCGCGGTCAC
CATCCGTGCTGCCGCCAAAGACGTCGACGCCCTCGTCCCAGCGCACAACGCCCGATCCGAACCGCAAGACCTACACCGCA
GGCCTCTCGGCCGGCTCGTCGGCCAACTACAATGCTGCGCGCAACTCGGTCGGCTCGGTGCAGCCTCGACTGCCACAGGC
AAGCATGCCCATTCCCATCAATAGCTCGCGCCTGCCAGGCCCTAAGACGCTGGCACCACGAACCTCCATGTCCAATCTCG
ACGATGGCGAGGACGTGCCGCCGGTGCCGGCCATTCCCAAGGCGTACGAGTCACCCAAGGGCTCGCCGGCCGAGCTGTCC
TTTTTGGAGAAGCGCAAGTCCGGCCTTGCCTTTGACAGCAGCAGCACCCGCAGCACGTCGACCGCGAGCCTCTCCGGCAG
CCATCCGCAGTCGTTGGAACCGCCGGCTAAGATCCAGCGCCAGGCCAGCACACGGGCTTTCCGAAGCGGTGACAAGACGA
GCCAGCTGAGCCAGATGAGCCAGCTGAATCAAGCGAGCCAGACCAGTCAGGCAAGTCAGGCAAGTCAGGCAAGTCAGCCA
GCCAACGGTGTAGCTACATCGAATGGCAACAACAAGAAAAACCTGCAGCCACTGCGATTGCCACCCATCAACCTGCAGCC
GTTGAGCACACCCACGACCGCAAAGATCGCCGCCCTGCAACAGAAGAACACGACGAACCGGAATCTCAGCCCGCCGCCGT
CCCGCATCATCGCCAAGACCCCGACCACGCCAATGACGGCCAAGGGGTCCTTCTTTTCGCGGCACCGCCACGACGACGAC
CTGGCTGACTTCCCGGCAGCCATACGGAGCAGCTCGTCCGTACACCACCACACACGTCGCGACTCGCCGAGCGGCGAAGA
TACCGCCAGCTCGTCCGACTCCATCGCGCCTGTCCCGACGAAATCGCCGTTCCACAAGCCGTCCATGTCGCCGTTCTCGT
CCTCGTCCGTCCCCAAGGGCGGCAGCCCTATGAGCACCAACATGTTCAAACGGCGCACCATCGACGGCAACGACGGCGAC
TTTGCCGGCGTGTTCACAACCCCGGCTCTGCCACCAATACCGGTCACCACACCGCACAGGCCGTCGGGACCGCGCGCGCC
GGCACCGACGCCGTCCAGAGCGTTTGCTGCCATGGAGGCCGCATCGGCCATCATCGCATCGGCGGCCGCTGCTATGGCCG
AGAACCCGATGCCGCCTCTGAAAACTGCCATGCTGCCGCCGGCCAAATCACCACCGCCGTTGTCCAGTCCAGAGGAGCCG
CCGACGCCGTCGTCCATCGGCTCGTCCCTTCGGCGGAAGCTGAGTCTGTCGTGGAAGCGCAACAACAAAGCTGTCGGTGG
GGCTCAGCCGGAAGTGGCCGTTCCATCGACTTCGGGCGACCCTTCCAAACAGCCGCAACCCCCACAGCAACACCACCTGC
CCTTTCACCACAAGCGCCAGTCCTCTGCTAACGTGAAGCACGACGGAATGCCGCCACCGCGCATTCCCATCTCGGCCACG
CTGAACTCACTCAAGGCGAGCCCGACGTCCGATCTGCCGAGGGATCCGACACGGCGGAAGACGTCTGCCTCGAGCATGAA
CGCCATCGTAGCACACGACAGGACAGACAAGAAGCGCATGGCAGACAGCCAGCACAAGAAGGAAATGACGATCAATACGT
TGATGGCGGCAGCAGAGGCCAACGCGAGCACGAGCACGGTATCGTCCACGCGCACGTACGCGACGCAGAACTCGTCGGCG
GTGCAGAAGATAGTCAAGGGAAAGGCATCGTCGAGCAGTCTCCGGCAGCAGAAGCAGTCGTCGCAGCAGTCGGCGCCACA
GCAGCACCTGACCCACCGGCATCGGCACCACGAGAAGACAGAGGCGGTATCGACGTCGGCCCTGGACAAGGACGACCTGG
TGGCGGAAGAGGAGATGCGGAAGCTGGGCTCGCGCCGCAAGGAAACGGAGCTGGCAGCACGGACGCTGGACGCGCTGCGC
AAGCGGGCGACGCCCAAGGAGCGGGTCAGCCCGCAGGAGGCGATCCGCATTGCGATGCTAAACATTTACGAGCGCGGCGA
GATCATCGACTACAACGACGTGTACTTTTGCGGGACGCAGAACGCGGCCAAGGTGGTGGGTGACCTGCACGCGGATCTGC
CCAACTTTGGCTACGACGACGAGCGCGGCGACTACTCGATCGTGCCGGGCGACCATCTGGCGTACCGGTACGAGATCATC
GACCTGCTGGGCAAGGGCAGCTTCGGCCAGGTGGTACGCTGCATCGACCACAAGACAGGCGTGCTCGTGGCGGTCAAGAT
CATCCGGAATAAGAAACGGTTCCACCAGCAGGCCCTGGTGGAGGTGAACATTCTGCAGAAGCTGCGCGAATGGGTGTGTA
TCTGTTTGTCCTCCCTTTTTCTGCTCCGACTGACCGTGTAGGACCCTCAAAACAAACACAGCATGGTCAACTTCACGCAC
AGCTTCTACTTCCGTGGCCACCTGTGCATCTCGACGGAGCTGCTGGACATGAACCTGTACGAGTTTATCAAGGCGAACGG
GTTCCGCGGCTTCTCGATCAAGATGATCCGACGGTTCACAAAGCAGCTGCTGGGCTCGCTGATGCTGCTGAAGCAGCACC
GGGTGATCCACTGCGATCTGAAGCCGGAAAACATCCTGCTGCGGCACCCGCTGCACACGGAGATCAAGACGATCGACTTT
GGGTCCAGCTGCTTCGAGAACGAAAAGGTGTACACGTACATCCAGTCGCGCTTCTACCGGTCACCCGAGGTGATCCTGGG
CATGACGTACGGCATGCCGATCGACATGTGGAGTCTGGGCTGCATCCTGGCGGAGCTGTACACGGGCGTGCCCATCTTCC
CGGGCGAGAACGAGCAGGAGCAGCTGGCCTGCATCATGGAGGTGTTTGGGCCTCCGGAGAAGCACCTGATCGAGAAGAGC
ACGCGCAAGAAGCTCTTCTTCGACAGCATGGGCAAGCCGCGGCTGACGGTGTCGTCCAAGGGCCGGCGACGACGGCCGTC
ATCCAAGACGCTGCAGCAGGCGATCAAGTGCGACGACGAGCCGTTCCTGGACTTTCTGGGGCGCTGTCTGCGCTGGGACC
CAGATCGCCGGCTCAAGCCGGAGGAGGCGCTGCGGCACGAGTTTATCACGCACCAGAAGACGGTACCGATGCTGATGGGG
CGAGCGAGCAACGGCAGCGTCTTTGCGCTGTCTTCGGGAGGCGGCAGCGGGAGCAGTAACAGCCGCGACGGCGGGTCGCC
CATCCGACGACACAACACAATAGTCGGCACCGGACCACGGCCACTGCCGGAGCCTCCGGCCGGATCAGGATTGACGACGA
AGCTGAGCGCGCCGCCGACGATGCGAGCCGTGGGCGGAGTAGCGGGCAGCAGCATAGGGTCGAGTCCGCACAAGTCGAAC
AGCATGGGCCCGACGATGTCGTCGTCTCGACGGGCTTCGGCAGTGACAGGATCGACGGTGTCGGTGGCGAAGCGGACGAG
CGGTGGAACAGGAGGAGCTGCCGGGTCCAGCAGCAGCAACAACAACAACAACAACAACGGGGCCAATGGTCGCAGCAGCG
CCAGCGGCACAGGAGGCGTGATGAACAGCATGAGCAACATGAGCAGCAGCAACCTGCCACGGGCTGCCGGACGGGTCGTC
AGCGGCACCACCGCCAACAGGGCAGACCTGGCAGCAGCCGGGGCAACGGCAGCGATGACACGGCGAGCATGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62