GenePrediction:GLEAN_3294 Details

Name: GLEAN_3294
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:420430..420672 (+ strand)
Length: 243
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:420430..420672 (+ strand)
Length: 243
>GLEAN_3294 class=GenePrediction position=GCSC_89:420430..420672 (+ strand)
ATGTGTTACCGTCTGGTCGAACGCTTTTCCGTCTGCGGATGCGTCTACCACCAACACGCAGTCGACCGATGTGCGGCGTA
CAACCAATCCGGCCACAAGATCCAAGAGCGGATAATCCCTGTGGGATACACCTGCTCGCTTCACTCGGAACCCACACAGG
GCTCCTACGGCGACGATACATACACCTACTCGGACTCTGGCTACTACAGCGGCCAGTCTCACCAGAGCTCCAAGTACCGG
TGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62