GenePrediction:GLEAN_3296 Details

Name: GLEAN_3296
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:436651..438738 (+ strand)
Length: 2088
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:436651..436797 (+ strand)
Length: 147
Type: CDS
Source: GLEAN
Position: GCSC_89:436951..438738 (+ strand)
Length: 1788
>GLEAN_3296 class=GenePrediction position=GCSC_89:436651..438738 (+ strand)
ATGAACTCCATCTTTCGCTTGCCAAACGAACTCACGTTTGCCATTGTACAACAGCTCTCCATCGTGGACGCCTTTGGGCT
GAGCCAAACGTGTTGGCGCTTTCAGAACCTCTTTTGCGATAACAGCATCTGCCGCTCTCTCCTCGAGGTAGGTGCCCGAT
TCAAACCCAACACCCCCCTTTTCACATGGATGGCCACTGACTTGGGCTGCATTGTTGGGCTGCAATGTGCAAAAACCACT
TTCCCGCTCGCTTCGCACACGTCCTCGGGGCCCATTGCAACTGCTGACCGGTGCCTACAGAGCCAAGCTGCTTTTTCCTC
CGAGTTTCTCGAGGCAAAAGAGACGCAGCAGTACGCTCGCGCATTCCGTCTGCTGGCTAAACGAAGACTCGCCATATCTA
ATCTGGAGCCGTTTGCCACCGCCATCATTGCTGTAGCAGACTCCCATCTTTACGTAAATGGCACCCTACTCTACATCATT
GAGCGTAAGCTGTTCATCTTGCCGCTCCGTGGCAATGCTCGCAGCGAGTATGTGGTACACATACGCAAGTTGCTGGATCG
AGCGGTCGACGAGTCCAGGGATACGACAAAGTACAAGTTCATACTGCTGCACTATGCAGACGGCATTGTGACATGTCGCT
ACACGCACTGCCGGACCACCAATGAGACCTGGCTGGTCGTCTTTAGCATACGGGAACACTGGACGCGCAGCGTCCGGGTG
CCCTTACCGACAAGGCTGTTTGCCCGCAGCAACAAGGACTACGTCATCTTTGGCACCTACACCGGCCAAGGCGACGATGG
GCACCGACGATGGGTCTTGCGGCGCTATTCCATTCGCGAGGAACGCCTCGTGGGAACGAGCAGGTATCTAGACCGGGTCC
TTGGCTCCGACATTGGCGTCAATGTGTATTTTGACATTATCGGCGACTGTTTCTACGCCCTATCCAACCAGACTAGCCTC
GAGCTCATGGTCGGAATCACCGATTCGTACTACTACTGCTGTCGCTTTCCGCTGTCGGATATGGATGCCATAACCGAGGC
CACATCCGATTCGCTCTGGCGACGTCTGAATGCCGAAGGCACCATTGACGAGCGCTGGTCCTTTATCCGCATGGTCGCCG
ACGAGGAGACCGGCAGGCTGACCATTCTCGAGTCGCGGAAAGAGTGGCGCTTCGGCAGCAGCGACAGTCGCCGAACATAT
TACACCCAGGAGGTCGTCTTCCCGACCAAGGATGACGCTGTCCTGTCATGCAGAACAGGTGGCCGCATTGGTGCTGCGCT
GGACGTCTTCTATCATGACGCCTCTAGCAGCTCAAGACCGGATGGATGGAGACGCCAAAACGACTTTCCCGACATGGCAG
ACGTCGACCGGAAGCAGCACATCCCCCGCAGGAGTCCAGAAAACGTACATCCTGGCGATGACTCGTCCAAGATGATGCCG
TTTACGCCCAGCACCTGTCTGGTTCGCGCATACTTTCCCACCTGCTCGACCTTTCTCGATCTGGTAAACCTTCCGGCCGA
GACCGATCCGGCCGCAAGACGGCTGCGTCTCCGTGCTGGCAGTAGAAAACCGCGGTCTGCCTGCCCAATGCTGCCCAGCC
CGGACAGCCCAAGGGACGAGGCCGGCGAAGACGAAGAACAGCTATACCCGCTGCGTGAAATCGAGCAGCAGTTTGCCACG
ATCGAGCCGACAACGTGGCCACCGGCCGTCCAGGGCCAACAGGCCTCGCGCAACCTCGTTCTCGACCGGATCATGAACCC
CAATGGCCACCAGGGCGAGGTTTCGGGCACGTGGGACGACCGGTCACTGCTCTACTCCATCGAGGGCGATGACAAAATGC
ACGCCCTGGTGTTTATCAGCTTCGATGCCTCCGTCCGTCTGCCGCATTTGCGGCCATGGCACGACAGACCGGACAGGGCA
GTGACCCGGTCTGCGGCCGTGTCAGTGTCCTCCTCTCCCGACTATCGGCAGTATATCGACCTATCCGACGACGACCCAAC
GCCCGAAGGGTTGCAGCCAGATTGGCTTTCGTCAAACAACGTGCCCTTGTACAAAGACATCGATATGGGATATCACTTTT
TCTACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62