GenePrediction:GLEAN_3299 Details

Name: GLEAN_3299
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:468964..472049 (+ strand)
Length: 3086
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:468964..469134 (+ strand)
Length: 171
Type: CDS
Source: GLEAN
Position: GCSC_89:469192..469420 (+ strand)
Length: 229
Type: CDS
Source: GLEAN
Position: GCSC_89:469540..469620 (+ strand)
Length: 81
Type: CDS
Source: GLEAN
Position: GCSC_89:469681..470042 (+ strand)
Length: 362
Type: CDS
Source: GLEAN
Position: GCSC_89:470153..470395 (+ strand)
Length: 243
Type: CDS
Source: GLEAN
Position: GCSC_89:470457..470750 (+ strand)
Length: 294
Type: CDS
Source: GLEAN
Position: GCSC_89:470823..471253 (+ strand)
Length: 431
Type: CDS
Source: GLEAN
Position: GCSC_89:471318..471685 (+ strand)
Length: 368
Type: CDS
Source: GLEAN
Position: GCSC_89:471949..472049 (+ strand)
Length: 101
>GLEAN_3299 class=GenePrediction position=GCSC_89:468964..472049 (+ strand)
ATGGAATTCTTTGACCCTCTCAGCCATCTCACTCAGCCTGCGGTTGAGAATCTTCCCAAGCTGGAACAGCCCGCCGCTGT
CCACACTCGCTATACCGTCAAGAGCGAGGGAGATGCTTCCGTTAGCGCATCCAACGCGACCGTGCACGCCAATATTTGGT
TCAAGTCGCCGGTTGGTTTCTTGACCTATACAATTATAACTGGCACCAATGTAACTGACTCTCCTTAGCCACTCACCACC
CAAACCCTCCGTATGATTCGCGCGATTAAACTCTTTGCAGAGTCGCACGATCAAGGGTTCATCTCCAATGTGGGGCAGGG
CAACTGGACCTGGTTCGAGCTAGTCATCCTCGACAACAAAGACGTGACGTCGCCTAAGAAGGACGGCAATGGCAAGGAGC
TTGTCGTCATAAGCCACCCCAACAAAGCCGCTTCCAAAGACTACGAATGGATGCAGGGTGAGACTTTTGACATGAGCTGT
CATTTTTTGAAGTCGCTCGAGGTGAGTACAAGTTTTTCCCAAGCCCTCCTCGGTCTCTGACTGACTTGATGACACAGGCT
GAAAATGTGATTGCAGTCCGGCTTTGCGCTCGCTTCGCTTATTGGAAGATCTTTGCGAGGAATGGACACCTCGTTATTGA
CATTAGCGATGACAACAGTAGGTATAACATCAATACAGAAACCTTATTATGGCAACGTATTCTAATCGAGTTTCCAGACC
CTTTCCCGATCACCCCAATTTCCATCAATACCAATGATACGATTCCTTCTCATCGAAACGTCGAGGAATGGTACGCAGAG
GCGAAGACCGACAGCAAGACGGCGCTCGAGCTCTCTTTGTTCATTCGAGCCTTAAAGGCCTTCCAGAGCCTTCCTCCTAA
TGACCAACTCTCGTACTACCGCATCGCTGCCATTCACGGCCATCCCCACAATGTTTCGTGGAACATGGGTGAAGCACCGA
TCCCGCTCGATGCCGGGGACATCAACACCCTGAAATTGGAGAATAAGGGTGGTAACTACTGCCAGCATAACAATTACTTG
TTTCCCACTTGGCACCGCACGTACATGATGTTATTCGAGGTATGTACGACCTCTTTCACACATCCAAGAGTAGGGAACTG
ATAATGTATGTAGCGACGAGTCAGCGACCTCATGATGGAAGAAGCTGTGACTCGTGACCCAAAAAAAAGGAATGGGTTTC
TGCTGCAAGCCTTTGGCGCTTGCCCTACTGGGACTGGGCTCTGAAGCCAAGTCTTCCCAACCTAGCCCGGGACAAGAAGA
TTTCGATCATCAGCTCTTGGGACAGCAAAGACCTACCCCAGTATGAAGAAGTGGATAACCCCATGTATCGGTTCCAGATG
CCTGGTCACAAGCCCATGGGCGATGCCATATACAAAAACTACCGCATCGACAACAAAGATGAAGATATCCCGGTAAGTAT
CAACCAGCTGAAAACCTTGTAGCCTTCCCACGGCCATGCTAATCAACGCTCAGTGGGATATGTGCATCGGCACCAGTCGC
CATGGCATCACACTCCGTGACGAAGAACGAAAGTGGATTGAGGGAGTATCCATCAACGAGAAAGTGGACTTGTCCTTGGC
AGGCGTTCACGAAGACCTGAACAACCTCACGCTTAAGGACGCTGTCTTTCGTCTACTTACGCGCGATTACACCACCAAAT
ACGTGAATTTCGCTTCTACCAAGCACGTCGCGGAAAATCTAGAGAACGCACCGGGAGACACTGCCAAGGGTTATCTCAGC
CTAGAGCAGATTCACAACAGTGTCCACGTAAGTTTTTTTCTCTTTTTCGTCCCATGCAAGTTTCAGGTCTTTGGGACAGC
GTCACTAATGTACTGATAGGACTTCATTGGCGGCAATACAAATCGTGCTGGTAGAGGCCACATGAGCTCAGTCGCAGTAG
CCGCATTCGACCCCGTTTTCTGGCTGCATCATTGCAATACCGACAGACTCCTTCACTTGTGGCAATGCTCCAACCCGGGC
AACTGGTTCCACCAGAAGCTGGGGCAAGTGGCTTCTGACAGCCCTCTGGAAAATCTTGTTCCCTTCCGTGCTTCAACTGA
ACCCGATAACTTCTTCAATTCCAACAACGTTCGCCATGTTGATGCGCTCAACTATACCTATAACTATATGGATCAGATCA
CTGATAAGTTTGGAGACATAATTCCGGGAAAGTGTCACACCTACATCAACAAGCTGTACGGGCCCGATGAAGAAGCCTTT
AAGAATCCAGAAGAGTCAACAGACCCTCTCATCAATATCGTCTACAACCGGTATGTTACGAAGACTTCCTCACCATATTA
CTTGCATTCTTTACTCTAACATTCTTCAACTTAGCTATTGTTTGAACGGAAAATCATACTCCTTGCTCTTCTTCCTTGGT
GATGTTGACCCCGAAGCGCCTTACAACCAACAGAAGAATCTTGTTGGCAGCATCTTCACATTCAGCTCTGCCCTCAAGGA
GGACGCCATTACCTGCAAGAACTGCTATGAACAAAAGCGTGTCAATGTCCTGTCTCGCGCCCAAGTCCCGCTCACGCGTG
CCGTGCCCATCCAGCATCGTGAAAATTCAGCAGCAGCCTTGGAATATTTTCAGGAACATCTCAAATGGACTGCCATCAGT
GAGGCTGGCGAGGTGATTGCCTGGGAAAAATTGACAGACCTGAAGATCACACTGTTCATTGGAGTGAATCAGCTTCACGG
CAGTTTGGGCAGAAATTCATTGTTCAGGTTTCATAGTTATAAGGAAAAGGAGTTCGACTGGGAGAGTTCTTATTTTGCTG
GCGCGAATCAATTTTAGGGTCAGGTTGAAAAGGCTCGTACTCGGTTTGTAAAATCGAAGCAATGTTGAATAGGTGAAGCG
TTGGACGGTTAGATAGTCATAGTATGTCTCAGAAAACTCAATATACGGTGGGAGGTCTGGGGAAAAGAAGTTGCCATAGC
TGCAGCTCTAACCCGGGTTTCCTAGACAAGTTGCCCGGCCCACTGAGCTACCACATTCGCTGGGTCTCATCTCGCCAAGA
TTACAAGTGTTATGAGCTGGAGCCAGGAAGTTCTGGAGACCTCTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62