GenePrediction:GLEAN_329 Details

Name: GLEAN_329
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1097902..1099944 (+ strand)
Length: 2043
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1097902..1098979 (+ strand)
Length: 1078
Type: CDS
Source: GLEAN
Position: GCSC_167:1099036..1099140 (+ strand)
Length: 105
Type: CDS
Source: GLEAN
Position: GCSC_167:1099205..1099808 (+ strand)
Length: 604
Type: CDS
Source: GLEAN
Position: GCSC_167:1099875..1099944 (+ strand)
Length: 70
>GLEAN_329 class=GenePrediction position=GCSC_167:1097902..1099944 (+ strand)
ATGGAGCAAACACATGAAACGGAAGAGGCCGGGGCTGGCGCAAAGGCCGAAGCAAAGCCAGAGAGGCCGCATGGGAGCAT
GACAGGCGAGCATACTTCGGCTCCCTCTGGTAGTGACGACGTCAGTAGCGACGACGGCGCCAGCGACCATGGCGGTGAAG
CAAACTTGGTCGAATGCAAGGTGGACGGCTGTCATGAGGTCATTGATCTAGCAGGAATGATGTATCATCTCGATCTGCAC
GCTGCCCTCGACTGTCAAGAAGACGGACATGAAGATGGGCATGTGGACGAGCCGGCCGAGGCCGACGGCGATGCCAGCGA
GCCAGAGGCCGAGTCTGAGGCGGAAGGCAGAGCCGAGAGGAAGGTCAGGGGTAACAGTCAAAAGCCACCGCATTCTTCGT
CTAGCTACAAGAGCTTCAAGAGCCCCAAGAGCTCCCACGCCGAAAACCGCGCATCGGTCCGAGTCTCCTCCCGACGGAGA
AACACCGGGGGGTCTTCTCACGAGGCCAACGCGAATCGTTCTGTCGACGTGACGGCCGATGGAAATGCCGACGAGCGGCG
GCGACGGCACAGCCAGCATGCGAAACATGGACACAAATCTCGTCCACGAGCGCACACGGTAGATGGCATTGCAAGTCATG
TGGACAACGACGAGCATCCGCGCGACCGCCATCGAGAGCGTCGCGACAGGGAGAGAACCCACGTTCACAGCCGAGATCAC
CGGCGCATACACAGCCACGAACACGATCGCGAGCACGAGCTGGAGACCATGACGGGAACAGGCTCGCCAGGACCGATGGC
TCGCAGGTTTTCCCGGTCATCGCGCCCGTCTTGGTGGCCGTTCCGATCTGTTTTGGAGCACAGGCGGGACATGTCGATAG
GAAAGAGCCGACGGCCGGTTTCGGTTTCGTCGAAAGTCAAAGACAGCAGCGGCGGGACCGCAGTCTCGACTGCAGCAGTG
CCGGCAAAACCAAAGCAGCGTCTCGGTAAGGCCGAGCTTGGCCGTTACGCCCACGAAGAACGCATGCCAGACTGGCTTGC
CGTCTACCTTAAGAAGGAGTGGGGAGTGTGCCACAACGGTGAGTTGCAACCCGGCCGTGTCTCCTGCCGCAAGCGGGTGC
TGACAGTCTTCAAGGAGTCATACCGGTGTTGAAGCAGCTGCTTGAGCAGAGTCCGACGACGGAGTACGCATACCTCTGCG
ACCCGTGTGTGACACATGTGTCCCGGTTGCAGAAAGAAGGTGAGATAGACTCTTTGCGGGGGTGATATCTGGCTTTGGCC
GGCTGCTTACGGTGTCGCACCAGGTGGATTCTGTGGATATCGCAACATCCAGACGATGGTGTCCTACGTTGTGGGAGCCA
AGTTTCCTGGCTACAACCTGTTTGGGGACGACCTTCCGAACATCTTCGATATCCAGAACATCATCGAGAATGCATGGGAC
ATGGGTATCAATGCGAGCGGACGCGTGGAAACCGGTGGTATCCGCTGGACGCGCAAGTACATTGGAACGCCGGAGGCGAT
GGCTATGTTCCGGAGCCTCAACATTCCGTGCAACGTGCAGGCGTTCAACCACCGCAAGACGGGGCGAGCAGCGGAACTGA
TGCTGCGCGAAGTGGAACGATACTTTGAGACGGGAAAATACCGAATGGGCCGCAAAGTGCGAGCGACCTCGCTGCCGCCG
ATCTACTGGCAGCACCCGGGCCACTCGCTCACGATTGTCGGCATCGAGAAGACTACGGCGGGACAGACGAATCTCCTAGT
TTTTGATCCCATCTTCAAGGACGGCTCGCCTATTGTGCGGCTGATTGGCCGCCAGCGATTCGAAGCGCGCTATCCCGACA
AGCTGCTGCAGCTGTACCGACGAGGGCCACGATATCTCGGCCGTTTCAAGGCGTTTGAGCTGCTGAAGTAGGTTTACTTT
GCTTCTACGGGCTGTCCTGCCTTGCTGCTTACTAACCGCGAGTGCTGCTGCAGGCTTGATCCGAGAGCAGAAGACGTCGT
GCAGCTCGACGGTGACGAAACTCCTGGTCCCAGCAGCCAATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62