GenePrediction:GLEAN_3300 Details

Name: GLEAN_3300
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:474824..476036 (+ strand)
Length: 1213
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:474824..474968 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_89:475041..475050 (+ strand)
Length: 10
Type: CDS
Source: GLEAN
Position: GCSC_89:475126..475149 (+ strand)
Length: 24
Type: CDS
Source: GLEAN
Position: GCSC_89:475203..475347 (+ strand)
Length: 145
Type: CDS
Source: GLEAN
Position: GCSC_89:475408..475713 (+ strand)
Length: 306
Type: CDS
Source: GLEAN
Position: GCSC_89:475775..475902 (+ strand)
Length: 128
Type: CDS
Source: GLEAN
Position: GCSC_89:475970..476036 (+ strand)
Length: 67
>GLEAN_3300 class=GenePrediction position=GCSC_89:474824..476036 (+ strand)
ATGCAGCTCACAGCCGCTATCTGCTGGGGCGCCTTGCTTCTTTCGTCAGCGTTTGCAGCCGTCGATGGCTCCAAGCGGAC
TCCGAGAAGGTTTCGGAGAGACTTGGCAGATGATACCACGGGCCCGCAACCAAAAAAACACTTCCGTACGCTTTTCCTAT
CTTTTCGTTGTGGACAATCCATCCTACTTCATCGGTGACTGACCTGTCTATTTCCAGACGAGTTACAGTAAGAGGCGTAT
CCAGCAGTACTCAAGAGTGCCAGACATCCAAGATCTAGACTGCTAACCTTGTTGCCACGTAGATTCCATGTACACTACGA
TGCACGGTAAGAAGGCCCCCAGATTCACAATACCATGTTCAGGTCCTGACTCTTCGCAGTTTCGCCGAAGGCGTGCTTGT
ATATGCTGAGCACAGGCTGGCTCTGCAGAACCTAGTCCAGACGTACCTGGCCACCTTTGCCGACATTGGCGTAGAGACCT
GGCTCATGCATGGTTCTCTGCTGGGCTGGTGGTGGAACAAACAGGTGCGTGGCGACGGCTTCAGCAAACTTTTCCGTTCT
CGTATCTAACCGGCCAATAAACAGATCCTGCCGTGGGACACAGACCTAGACGTCCAAGTTAGCGAGCCAAGCATGTACTA
TCTTGCCGCCTACTACAACATGTCCATCTTCCACTACAAGACCCCGCGGCTACCCAACGGCCGAAAATACCTGCTGGAGG
TTAATCCCAACTATGTGAACCGTGAGCAGACTGACAAACTGAACGTTATCGACGCCCGGTGGATCGATACCGAAACGGGA
GTGTTTATCGACATCACCACCGCACGCTACAACCTGACCCATCCGGCCGGCGAAGGCATGCTCAGCTGCAAGGATGGCCA
CGAGTACAGGGTAGGTTGCGTTTCCCAAAACTCGGCGCGGCTGCAGCAAACAAGCTGACTTGTGCATTAAGGACACATAC
ATCTTCCCGTTACGGAACACCGTTTTCGAGGGTACTCCCGTCAAGATTCCTTATCGCTACAGGGATCTTCTCGTGGCAGA
GTACGGTACTTGGGCCCTTGCCAACACTGACTTTCACGAGTGCGTATTCCATAACGACCTATGGCTCACCCTTCTTTGTT
TTATGACGACTAACAGGGAGAACTAGCCACATCTTTGACGGCGAGACAATGCAGTGGGTGCATAAAGAGAACTACATCCA
GCCGGAGATCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62