GenePrediction:GLEAN_3301 Details

Name: GLEAN_3301
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:476626..477521 (+ strand)
Length: 896
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:476626..476978 (+ strand)
Length: 353
Type: CDS
Source: GLEAN
Position: GCSC_89:477053..477521 (+ strand)
Length: 469
>GLEAN_3301 class=GenePrediction position=GCSC_89:476626..477521 (+ strand)
ATGGCAGTCAGTAAAGCGGCAGCAGCACCAGCACCGGCGTCTCGGCCGCTGCGGTCGTCCAAGCGCAAGAGCGGCGGCTC
TGTTGCCGACTTGCAGAGCACCGAGCCGATGGAGACCGATGTGGCGAGCGCCGCCGCATCCGGGCCCGTATCCAAGCGGC
GCAAGCTTCCGGTGCGGACGAGGGCTGACGATGCGGCCTTGGCGGAAGAGACAGGACAGACTGTGGAGGACGACGAGGAC
GACGAGGACGTGAGCGACAGCGACAGCGATGACGCCCCCGAAGCCATCTCCACCAGCCAGGCGGTCGCGGCTACCCGGCA
GTCGGCCCAGCGCGCCAGCCAGGCGGCCGAGAAGTGAGTTGCCGCCTCTTCTCTCTTTTCGTGTCCACCATTCCACCCTC
CTAGATACCTCTCTGACTCTCTCCCAGGCTGGCTGCCGACCAGAGGCGCCGCCGCCAGGACCGCGACGCACGACTCAAGG
AGCAGGCGGCCACACGCAAGGCGCGTGAGGCCGACGAGGAAAAGGAACAGACAACAGCAGCAGCTGTGGTAGCAACAAAG
GCCAAGGCGGACACAGCACCAAAGCCCAACAAGGTGACGAAGCTGTTGCCGCTCGAGTTCCTCGAATCCGACGACGAGCA
GTCCGACGACGACGAGGCAGAAGGCGCCAAGAAACCGTCGGCCACTGGGACGGCGGCACGACGCAGAAACATCGCCGGCA
AGCTGCCGCCGCGCGACCGCCGCCAGGGCAGCACCGTGTACCGACTGCTCACCGACGGCGGCCCGCGGGCGCTGGCTCCC
AAGATCCGCAAGTACTCGCGCAACGTGCGGAAGGAGCTGGTGGCGCGGAAGCGCACCGGCCGGCCGATCAGTCGCGGCTT
TCTGGTCAAGCGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62