GenePrediction:GLEAN_3303 Details

Name: GLEAN_3303
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:494765..496463 (+ strand)
Length: 1699
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:494765..494782 (+ strand)
Length: 18
Type: CDS
Source: GLEAN
Position: GCSC_89:494868..494915 (+ strand)
Length: 48
Type: CDS
Source: GLEAN
Position: GCSC_89:495082..495154 (+ strand)
Length: 73
Type: CDS
Source: GLEAN
Position: GCSC_89:495229..495308 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_89:495369..495719 (+ strand)
Length: 351
Type: CDS
Source: GLEAN
Position: GCSC_89:495767..496276 (+ strand)
Length: 510
Type: CDS
Source: GLEAN
Position: GCSC_89:496341..496463 (+ strand)
Length: 123
>GLEAN_3303 class=GenePrediction position=GCSC_89:494765..496463 (+ strand)
ATGAAGGTGACATTCAAGGTAAGAAGAAAGGTTTCGACGATGTGGCCTGCCAGAACTATGACGGCTCGTCCGACGCTTAT
CCATTGCTGACTCTCTGGTGCAGGATCTGAAGCAGCAAAAATTCGTCATCGAGATCGAGCCCTCGGAGACGGTACGTCTA
TCTTTCCTCCCGTCGTTTTCTCTTCCCAGGCTGCACGACACAAGCCTCGAGCTCGCGCATCACTTGTTCCACTCCCCTGT
CTCTCCGCATTATGTTACTCGGGCGAAGTCATGGCGAGAGGCCCGAGCTGACATGTACTTTGTTCTTGCCTCACCAGATT
GCCGCAGTCAAGCAGAAGATCTCGGACGAGCGCGGATGGGCGCCAAAAACACAGAAACTCATCTACTCGGGTACGTTGCG
CAATGGAAGGACCGGCCGGCTTGTGAAATGGTGAAGCCACAGTACTGATGCCCCCGGATGGCAGGCAAGATTCTGAAAGA
TGAAGACACGGTCGAGTCGTACAAGATCGAAGAGAAGGGCTTCGTGGTCTGCGTGGTGAACAAGGTGCGTCGGCCTAGAG
GATGGACGAGAGAAGAAGGACGATGCTAATGCTGCGGCCTACAGCCTAAGCCGGCGCCGGTGGCCGAGTCTTCATCAGCC
GCTTCGCCATCGACACCTGCTCGCGCGTCGGCTGTCGCGGCCACACCTGCTGCTCCTGCTGCTGCTGCTGCGGCCAGTTC
TGCTGCGATTGCGCAAGCGGCCGTCGCGGCCACACCAAGTCCGGCCGCCCGTGCTGCCGGTCCGACGGCTGGTGGTGCGA
CGTCTTACACCGACCCCAACTCCTTTTCGGTCGGTCCTGCGCTGCAGGAGGCCATCACAAACATGGAGGCGATGGGCTTT
GAACGCAGCCAGATCAGCGCGGCCATGCGCGCGGCCTACAACAACCCGGACCGTGCGGTCGAATATCTGCTGACAGTGGG
TGTCACCCAAACCAGACTGATTGGCTGTGCTTGTGCTGATAGCTCCAGGGCATTCCCGATAATCTGCAGCCACCGCCGGC
TGCGGCCGGCGCCGGCGCCGAAAGTGAAGCTGCGGCTGCGGCTCCAGCTGCAGCGGCAGCCCCTGCTGCCGGTATCGAAG
AGCACCCCGAGAGCGTGAATCTGTTTGACCTGGCTGCGCAGCACGGCCAGGGCGGCGGCAGCCGTGGTGCAGCTGCACAG
CCGTCGGCGGATAGTGCAGCGGCAGCGGCAGCAGCAGCTGCTGGCAGCCAGGGCCTCGGCAACCTGGACTTTTTGCGGCA
CAACGCGCAGTTCCAGCAGCTGCGCCAGGTGGTGCAGCAGCAGCCGCAGATGCTGGAGCCGATCCTGCAGCAGCTGGGCG
CGGGAAATCCGCAGCTGGCGCAGCTGATTGCGCAGAACCCGGACCAGTTCCTCAGCCTGCTGAGCGAGGATGGCGACGAG
GACGATGCGCCGCTGCCGCCCGGCGCGCAGGCGATCTCGGTGACGGAGGAGGAGCGGGACGCTATCGAACGTGTGAGTTT
GAGATCAGAGAGAAGCAGAGAGGAACAGAGCGGGACAGCTTGCTAACTCGGCCCAGCTCTGCCGCCTCGGCTTCGACCGG
GACCAGGCGATTCAGGCATACTTTGCGTGCGACAAGAACGAGGAGCTGGCGGCAAATTTCCTGTTTGACCAACCGGACGA
CGAGGATCTACAGGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62