GenePrediction:GLEAN_3304 Details

Name: GLEAN_3304
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:500217..502896 (+ strand)
Length: 2680
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:500217..500354 (+ strand)
Length: 138
Type: CDS
Source: GLEAN
Position: GCSC_89:500719..500862 (+ strand)
Length: 144
Type: CDS
Source: GLEAN
Position: GCSC_89:500929..500989 (+ strand)
Length: 61
Type: CDS
Source: GLEAN
Position: GCSC_89:501055..502664 (+ strand)
Length: 1610
Type: CDS
Source: GLEAN
Position: GCSC_89:502723..502896 (+ strand)
Length: 174
>GLEAN_3304 class=GenePrediction position=GCSC_89:500217..502896 (+ strand)
ATGGAGGACAGGAAGAGGCCGGCCATCGCCGACACCGATGAGTATGCACCACCAAGCAAGCGACAGGCCGTGAACGGTGG
TGGCAGCAGGGCAAAAGACGACAATAATGGTGACTACAAAGACGAGGCTTGGCTCGAGGTAAGGCATCACACGACGCAGA
CTTTCACCTCTCCATCCTGCAGATCGATTTGAGCCCCCTTTTTCCCGCTCGCACGCATCTGTTCTTTTCCTGACGCGCGT
CTTCCCCTCCTTCTACCTACATTCTCGCCCTGCCTGCATCACATGTCGTTGCTCCCAGAAGCTGTCTGTTCAGAAACTGT
TCTCCTGCCTCTGGGAGTGTCAGCCACGCCGGTTTCCATGCTAATGCGCCGCTTGCTGCAAAGCAGCAGGCATAGACCCT
CAAGGCTCTTCCTCCCCTGCTCACTGATATCCTGGCCCGTTTTGCTGGCGCTTCGCGCCCTTCGACATTCAGATGGACGA
TTGCTGACCGCGGGATCTCCAGGACTTTCAAAAAGACGCCCTTATCCGCCAGATGAACGAATACAAGAGGGAAAAAGCCA
CACTAGAAACTCGGATCGAAGAGATACAAAAGCGGTCGACGTATCATGATGACCACATCCGTATTGCCGATGCTTGGGTC
CTCCAGGTAGGCACACATCCCCCACCGCCGATGACGACCAAGCGGAAGACAGACATCCTAACCATCGCCTAGCTTTTGCA
AGAAATCGAGCTTCTCTGCGAAGGGACTGTGTCCAGCCACCCAGAATCGAAAGGTACGACCACCAGACCGCTAGACCGCT
GGAGCACATGGCCATGCTGACAGGCATCGATTTACTAGAACATCCCTACCCGTCTGCGCTGAGCTTCAAAGACAGCCGAG
ATTTTCAGAAGCACCTGGGTGAGAAGACAAAGGCAGTCAAGACGAGAATGGAGCTTCTCCTCAGCCGGCTTGCCGGCATG
CGCGAAGCAGTAAAACCCGAGGTCACCCAGCTGGAGACGCAAATCAAGACCTTGCTCGCCGCCCAAAAGGAATACGCCCT
ACAGCTGGACCGCCTGGAGACGGACAAGGAAGACATATCGCAGCAACTCGACACCGCGACACTACGGTATATCAAGGCCG
AAAAGCGGATAGATCGCATGCGCAGCCTACAGGTCCAGAAGATGGAAGAGAAGGCCTTGGCGCACGTCACCCCGCGGCCG
GCAGCCGAAAATGGAGGAGACGCGTCGGCGGCAAGTTCTGCCGATCTGCAGGCCCTGCAGGGGAAATATGACGAGAACCT
GGCTGCGTTTGCAAAGCAAAAAGAGCAGCTCGACCGGCTGTTTGCTGAACTGAAGGCCGCCCAGGACGAGAACAGCGCGT
TCAGAGCGAAGCGGGAAAGCGTATCGGAGGAGGACTATGCGCGGACAGACCTGTTTAAACAGCTGAAGAGCAAGAGTGAA
GACCTGATCCGGCGGGCCAACCACCTGGAAGCGACCAACAAGCAGCTGCGCGAGGAAATCGAGAAGCTGCAGACGGACCG
AACGGCCTTTCGAACGAAGCTCGAGCTGGAGGCGCAAGCGGTCACGAGCGAACTCGAGGACCAGATACAGGCGAAAGAGC
AGGATCTCACACGGATCCGATCGGCGCGGGATGAGTTGGTGGCTGACGTGCAGATCCGGAAGGCGAGCCAGGACCAGGAG
CGGACGGCATTCGAGCACATGAAGGAGCTAGTGACGGCCAAGGACGATCGCATAACGGCACTGGAGCTGGAGCTGGACCG
ACTACGACCGAGCGAGGACGGCAGCGACACGGCGACGACGGCGGAGTTGGAGGCGCTGTCGCCGGAACAGCTGCGAGAAC
GGTTGCTGAAGCTGGAGAAAGACTACGCGCTCATTCAGGCGGAAATGCCGTCGGTGGAGAAGGCGTATAAGCGGGCGATC
AGCCTGGCGCAGAAGAAGGTGATGGACTTCACGGCACTGGAGGAGCGGGTGACGATCCTGACGCTAGAGAAGGCTAAGGC
GGATCAGAAGTACTTCGCGGCACGCAAGGATATGGACATTCGCAATGCAGAGATCCGGGCGCTGCGGCACCAGAACAGCA
AGAGCTCAGAGATCATCACCTCGCTCAAGGAGGTGGAAGCACAGAGCCGGTCGCTGCTGAGCAACCTGGAAAAGCAGCTG
GCCGACTTCCGGCAATCCAACACGACGGTGGCAGACGAAAGCCGGATACTCAAGTCGGCCAACGCGGACATCACGCGGCG
GTTCGACTCGAGCAAGGGACAGATCATGGAGCTGACGAATCTGGTCAAGGCGCGGGACGTGGCAAACATCAGCTTGCGCG
AGCAGGCGGCAGCACACGAAACAGAGCTGGAGAAGCTCAAAGTGCGGATAGGACACCTGCAGAAGGACCGGGACAACTGG
AAGACGAAGTGCTTGGCCAACTCGTCGGAGGAAGAGGAGATGCTCAGGGTGAGTAGCGGTGGACGCGGAGACGAGAAAAG
GCGACGAATGCTGACTAAGACGATAGAAATTTGCGCTCTGCTCGGTGTGCCGCAACGACTTCAAGAACGCGATCATCAAG
ACATGCGGGCACGTGTTTTGCCAGTCATGTATCGATGCGCGGCTCAGCAACCGGATGAGAAAGTGTCCGACATGCAACAA
GGCCTTTGACAAGATGGACGTGATGACGGCACATTTATAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62