GenePrediction:GLEAN_3305 Details

Name: GLEAN_3305
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:505803..510074 (+ strand)
Length: 4272
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:505803..509629 (+ strand)
Length: 3827
Type: CDS
Source: GLEAN
Position: GCSC_89:509822..510074 (+ strand)
Length: 253
>GLEAN_3305 class=GenePrediction position=GCSC_89:505803..510074 (+ strand)
ATGGCTAAAGATAACCGCCTTTCGGAAAAGGATGCTGTCGCCACGGCGATCATGCCGCCCAAGTCTGCGTCCAGCCGAGA
GGACACGGGCGATGAGAAGGCGGCATCGAGTCTCGTCAAGATCGATTCGAAACCCGTGCAGCTCCCCGACCAGAAGAATG
CAGTGGACCCCTTTCAACACCTGCCGCCGGACGAGGCCTCTGTGCTGCGACGACAGGTGCTGACGCCCGAGGTCAAGGTC
GGCTTCCGCACGCTGTACCGCTACGCCTCGAGGACGGACGTGGCCATCCTGGTCGTGTCGGCCATCTGCGGCGCGGCATC
CGGCGCCGCACTGCCGCTGATGACAGTCGTGTTCGGCAACCTCCAGGGCAGCTTCCAAAAGTTCTTTCTCGGCACGCTCT
CCCGCCACGCATTCATGCACAAGATGGCCCACCAGGTGCTGTATTTTATCTACCTGGCCATCGGCGAGTTTGTCACCACG
TACATCTCCACAGTCGGCTTCATCTACACGGGCGAGCACATCAGCTCCAAGATCCGCGAGCACTACCTCGAGAGCTGCAT
GCGCCAAAACATTGGCTTCTTCGACAAGCTGGGCGCCGGCGAGGTCACGACGCGCATCACGGCCGACGCGAACCTGGTGC
AGGAGGGCATCTCAGAGAAGATTGGCCTGACGCTTGCGGCAGTGGCCACCTTTTTTACCGCCTTTGTCATCGGCTTCGTC
GAGTACTGGAAGATGACGCTGATCCTGCTGTCGACGGTGGTGGCGCTGGTTACTGTCATGGGCGGTGGGTCGCGCTTCAT
CGTCCGGTACAGCAAGCTGTCAGTGGCGGCTTATGCCGAGGGCGGCAGCGTGGCCGAGGAGGTCATCAGCTCGATCCGCA
ACAGCGTGGCCTTTGGCACGCAGGACCGCCTGGCCCGCCGCTACGACGAGTACCTGACACGGGCCGAAGGCCATGGCTTC
CGCGTCAAGGCGGTGCTCTCGATTATGATTGCCTGCATGATGTGCATCCTATACCTCAACTACGGCCTGGCCTTTTACGT
AGGCAGCAACTTTGTGCTCGACAATGTGATCCCGCTGTCCAAGGTGCTTATCATCATGATGTCCGTCATGATGGGCGCCT
TCAACCTGGGCAACGTGGCGCCCAACATCCAGGCCTTCACGACCGGCCTGGCGGCCGCGGCTAAGATCTTCAACACGATC
GACCGGATCTCGTGCCTGGACCCGACGTCAGACGAGGGCGAAAAGCCGGCTGGGCTGGTGGGCGCGATCCGGCTGGAGCA
CATCAAGCACATCTACCCGTCACGACCCGAGGTGGTGGTGATGGAGGACGTGTCGCTGGAGATTCCGGCCGGCAAGACGA
CGGCACTGGTGGGCGCTTCGGGGTCGGGCAAGTCGACCATTGTCGGCCTGGTCGAGCGGTTCTACCACCCGGTGCAGGGC
ACGGTCTACCTGGACGGCCACGACATCAGCAAGCTGAACCTGCGGTGGCTGCGGCAGAACATCTCGCTCGTGCAGCAGGA
GCCCATCTTGTTTGGCACGACCATCTATGAAAACATTGCTCACGGCCTCATCGGCAGCCGGCACGAGCAGGCGGGCGTGG
AGGAGAAGCTGGCGCTGATCGAGGACGCGGCACGCAAGGCCAACGCGCACGACTTCATCACCGGTCTGCCCGAGGGCTAC
GAGACAAACGTGGGCGAGCGCGGCTTCCTGCTGTCGGGCGGCCAGAAGCAGCGTATCGCCATTGCGCGGGCGATCGTGTC
GGACCCGAAGATCCTGCTGTTGGACGAGGCCACATCGGCGCTGGACACGCGGTCCGAGGGCGTGGTGCAGGCGGCTTTGG
ACGTAGCAGCTGCCGGACGGACGACCATTACGATTGCGCATCGACTGAGCACGATCAAGGACGCGCACAACATCGTGGTC
ATGTCGTCGGGGCGGATCGTCGAACAGGGCACGCACAACGAGCTGATCGAGCGGCGCGGCGCCTACTACAACCTGGTGGC
GGCACAGAGCATCGCGACCGTGAACGCACCGACGTCCGAGGAACAGGAAGCACTGGACGCCAAGGCAGACGCAGAACTGG
TGCGCAAGGTGACGGGTGGCAGCAGCAGCAGCAGCGCGGACGTGGAGGCCAAGGACGGCTCAGCCACAGAAGGCACAGCC
ACAGGAACGGGTGATTACTCAGCAGACCCGGACGACGACATGGCACGCAAGCTGCAGCGGTCGGCGACGCAGCACTCGCT
GTCGAGCCTGGCGGTGAAGGCGCGCAAGCCGGAGGCGGAAGACGCAGCGGCACGCTACGGGTTGATGACGCTGATCCGGC
TGATCGCAGGGTTCAACAGCTCAGAGTGGCCGCTGATGTGCGTGGCGCTGGTGTTCTCGATCATCTGCGGTGGCGGCAAC
CCGACGCAGGCGGTGTTCTTCGCGAAGCAGATCAGCACACTGTCGGTGGTGGTGACGCCACAGAACCGCGGCCAGGTGCG
GCACGATGCGCACTTTTGGTGTCTGATGTACCTGATGCTGGGACTGGTGCAACTGCTTGCATTTTCGATCCAGGGAGGCT
TATTCGCACTGTGCTCTGAACGGCTTGTGCATCGAGCACGTGACAGGGCCTTTCGCTCCATGTTGCGACAGGACATCTCC
TTCTTCGACCGGGACGAGAACACGGCGGGCGCACTGACATCGTTCCTGTCGACGGAGGTGACGCACGCTGCCGGGCTGAG
CGGCGCGACGCTAGGGACACTGCTGACGGTGGCGACGACGCTAATCGCCGCGCTGACGCTGTCGATTGCGATCGGGTGGA
AGCTGGCGCTGGTGTGCACGTCGACGATTCCGATCCTGCTGGGCTGCGGCTACTTCCGGTTCTGGATGCTGGCGCACTAC
CAGCGGCGGGCAAAGCGGGCCTACGAGGGCTCGGCGAGCTACGCGAGCGAGGCGATCACGGCCATCCGGACAGTGGCCTC
GCTGACGCGCGAAGACGACGTGGTGCAGCACTATCGCGCCGACCTGGCAGCACAGCTGCAGACATCGACGGTGTCGGTGC
TGCGGTCGTCGCTGCTGTACGCGGCGTCGCAATCGCTAACATTTCTGGTCCTGGCCCTGGGTTTCTGGTATGGTGGCAAG
CTGCTGTCGGAGGGGGCCTACGACATGTTCAGCTTCTTTGTCGTCTTCTCAGCCGTCACCTTTGGCGCCCAGTCAGCCGG
CACGTTCTTTTCCTTTGCGCCCGACATGGGCAAGGCCCGCCAGGCGAGCGCCGAGCTGAAGCACCTGTTTGAGCGCCCGG
TGGCCATTGACGCCTGGTCGACGGCTGGTCGATCGGTCGACTCGTTCGACCACCCGATCGAGTTCCGCGACGTCCACTTC
CGTTATCCCACCCGCCTCGAGCAGCCCGTGCTGCGCGGTCTCAGCCTGACCGTCCACCCGGGCCAGTACGTCGCCCTCGT
CGGTGCCTCCGGCTGCGGCAAGTCTACTACCATCGCCCTGCTCGAGCGCTTCTACGATCCGCTCGCCGGCGGCATCTTCC
TCGACGGCCACGACATTGCCGGTCTCAACGTGAGCGCCTATCGTCGCGGCATCGCCCTGGTCTCCCAGGAACCGACCCTG
TATATGGGCACTATCCGCGAGAACATTTTGTTGGGCGCCCTCGACGAGACCGCCGTGACCAACGAGGCCGTCGAGTTTGC
CTGCCGCGAGGCCAACATCTACGACTTCATCGTCAGCCTACCAGATGGCTTCAACACTCTCGTCGGTAGCAAGGGCGCGC
TCCTGTCGGGCGGCCAGAAACAACGCATCGCCATTGCGCGGGCCCTGATCCGGGATCCCAAGATTCTGTGAGCTTTTTTT
CTTTTTTTCTTTTTTTCTTTTTTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTT
CTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTTCTTCTTCTTCTCATCTTCTCTTTCTCT
CCCCCTGCTAACCCCCCAGACTCCTTGACGAAGCGACGTCTGCGCTCGACAGCGAGAGCGAAAAGGTCGTCCAGGCCGCC
CTCGACAAGGCCGCCAAAGGTCGCACCACCATCGCCGTCGCCCACCGCCTCAGCACGATCCAAAAGGCCGACGTGATCTA
CGTCTTCGACCAGGGCCGCATCGTCGAGCAGGGCACCCACGTCGAGCTCATGCAGCGCAACGGCCGCTACGCCGAGCTGG
TCAACCTGCAGAGCCTTGAAAAGCATCAGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62