GenePrediction:GLEAN_3306 Details

Name: GLEAN_3306
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:516731..520104 (+ strand)
Length: 3374
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:516731..517124 (+ strand)
Length: 394
Type: CDS
Source: GLEAN
Position: GCSC_89:517206..518980 (+ strand)
Length: 1775
Type: CDS
Source: GLEAN
Position: GCSC_89:519031..519771 (+ strand)
Length: 741
Type: CDS
Source: GLEAN
Position: GCSC_89:519859..520104 (+ strand)
Length: 246
>GLEAN_3306 class=GenePrediction position=GCSC_89:516731..520104 (+ strand)
ATGACGGCTTCGGGTGTGAGAAACAATGGCACGCGGGTGGCGGTCAAGCGAGAAGGCGGCGGCGACGAGAAGCGGTTCTC
TTCGGCGACGCCAAATGGCTTCAAGGACGACTCGCTCTCGCCCAGCATGTCGCCCGACCACAAGGCCGGCTCGCTCGACA
ACGCGTCGATGCCGGACACGGGGCCGGCGGCCAAGCTCAGCCGCAAGCCGTCGTCGTTGGCGCAAAAGGCAGCAGCAGCA
GCGGCTTCTCCTCGTGTGCTCTTTGATCACCTGCCCGATGCCACGGCCGAGGCCAAGGACCAGTTCCAGGTGATCACCGA
CTGTCTGTACGGGTCCAAGCACATGGGATCGTCGGAGCACGACGCTTTTGAGTGTGACTGTGCAGCAGAGTGGCGTATGT
TCTCTCTCCTTCCCTCTTTCTCTCTCTTTCTCTCCCCACTCTCTCTCTCTCTCTCTCTCTCCTAACGACTCCCAGACGAT
GGCCAGAACTTGGCCTGCGGCGAAGACAGCGATTGCATCAACCGGGCGACTAAGATGGAGTGCGTACGCGGCGACTGCAA
CTGTGGCGAGACGTGCCAGAACCAGCGATTCCAACGAAAGCAGTATGCGGCCGTGTCGGTGATCAAGACGGCCAAAAAGG
GCTTTGGGCTGCGGGCGGACGTGGCGCTGCGGGCCAACGACTTTGTGTACGAGTACATTGGCGAGGTGATCAACGAGCCG
GCCTTCCGGCGACGCATGTTGCAGTACGACGAGGAGGGCATCCGGCACTTTTACTTCATGTCGCTGACGAAGCACGAGTT
TGTCGACGCCACGCGCAAGGGCAATCTGGGCCGGTTCTGCAACCACTCGTGCCGGCCGAACTGTTATGTGGACAAGTGGG
TCGTCGGCGAGAAGCTGCGGATGGGCATCTTTGCTAGCCGGGCGATCGCTGCCGGCGAGGAGCTCGTGTTCGACTACAAC
GTCGACCGGTACGGCGCCGAGCCGCAGCCGTGCTACTGTGGCGAGCCCAACTGCAGCGGCTTCATCGGTGGCAAGACGCA
GACGGAGCGGGCGACGAAGCTGTCGGCAGCCACGATCGAGGCACTCGGCATCGACGATCCCGACAGCTGGGAGGTGGCAG
CAACAGCAGCCGCCGCCGCAACAGGAGCGCATCACGTGACCGGCCACAAGCCGTCGCGGCCACCACGCCGCAAGCGGGCC
AACGAGGACGACGAGGAGTATGTCGGAAGCCTGCAGCAGAGCGGCCTGGCCGAGGACGGCGTGACCAAGGTGATGGCGGC
CCTGATGCAGTGCAAGGAGAGGTGGATCGCAGTCAAGCTGCTGGCCCGCATCCAGGCAGCCGGCGACGACGAGCGCGTCC
TGCAGCGGGTCACGCGCATGCACGGCTACCAGATTCTCAGCGCCATCCTGACAGCCTTCCGGACGGACGACAACGTGGTG
CTGCAGGTGCTCGACGTGCTCGACCGCCTGCCGCGCCTGACTAAGAACAAGATTTCGGACTCGAACATCGAGTCGGTCAT
CGAGAGTCTCACGTCGGCCGTCCACGAGGACGTCGCGGCTGCGGCCCGACGTCTGCTCGACGCCTGGAGCAAGCTTGAGA
CCGCGTACCGGATCCCGCGCAAGAAGGTCGATCCCCATGCGGCGGTCGGAACGCGTGCGCGCAGCGGCCGTGCCAGCAGC
CTTGACGACGACGACAGCAGCAGCAGTGGACCCGCTCGCCAAACCCAGCCACAGACACAGCCACAGTCGCAGCCACAGCG
CAACCTATCGCCATTCCATGGCATGGCCGTTCCCAAAGGTCCGCGCAGCCATATCCCCCAGCGGAACGCCAACTTTTACA
ACAACGGCAACGGCAACGGCAACGGAAACACGGCGACGCCGCGGAACGCCCGCCGCCCGCTGCAGGGCCCGTCGTCGGCG
ACACCGACTTCAGGCCTGCCAGGGCTGCCGTCCGGCTGGTTCGAGGCCAAGGACCCCAACGGCACGACGTACTATTATGC
GACGGGCCGCGCGGCCACCTGGAAGCGACCGACGCAGCCGGCCGACAAGGCGCCGTCCAAGGCGCAGCAGAAGAGCGATG
CCGTGCAGGAGATCATCAACAGCATCGTCAAGGAGGACACGCCACGACCATCGGCAGGTCACACACCTCTTGCGGCAACG
ACCAAGGCAGCAACACCTGTGGCTGAGCCGAAAAAGGACCGGTGGCGGTCGTATCCGATCGAGAAGCAGATGAGGATCTA
CGAGAACACGGTATGTTGAGTGTGTCGACCGGGTGTCATGTACATGGACTGACGAGACAGCTCTCGCCGCACATCAGGAG
TGTGTCGGACCGATACCGTCATCGGCTACCCAAGGACGAGTTGAAGAAGCTGGCCAAGGACATTAGCAAGAAGCTGGTGG
CCTCCGACTACAAGAACAACCGGGTGGAAGATCCGACCGCGATCTCGCCGCGGGTCGAGAAGAAGGTCAAGACATACGTG
CGCGACTTTTTCGACCGTGCCGTCACCAAGTACGGCGAGCACGAGCGGAAGAGGGCCGAGCGCGAGGCGCGCCATGTGGC
GACGACGGCAGCCGCAGGTGCAGCCGTGGCTGTCGAGGAGGATGAGGACGGTGATGTCGTGATGGCCGACAGTCCAGGGG
AGGACCGGGAGGAGGAGGAGGAGGAGGATGCAGCGACAGCAGCGGCGGTAGCAGCAGCAGCAGCCCGGGACAAGGATGCA
GCAGTTGTGGCAGCGGCCCTGGCCGTGGCAGCGGCCGTGGCAGCGGCCAACGGAATCGTCGGGGTGGTGCCGGCCTTGCC
GACAAGACCGGCTGACAGCAACAAGGAGCGGGAAGAGGACCAGGCGACGGCGTCACCCGACGGCTCGCCGTCGGGCCGCA
AGCGGAAGCGCACCAGCAGCGACGTCCAGCAGCGAGACAGTCACGACGAGACCGACGAGCCGGCAGAGGGACAGCCGGCA
TCGTCGTCGGGCTCGCCGGCCGAGACACCGCCGTCGCTGCACAAGCGGCTTCGTGAGGACGACGTGGACGTGGACGTGGA
CGTGGACGGGACGCCACCACCACCACCGCCACCACCACCACCACCGCCCGAAGACACGGACGAGGACGGCGACGAGGCGG
ACGAACAGCTCCGGCAGATGCGCGAGCAGGAGGAAGAGCTGATGCGGGAGAACGAGGAGGCCATGCGGGCGTTTGAGCAG
GAAAAGGGGCAGCAGGAAGAAACCGGCCAGACGGGCCAGACAGAACAAAAGGAACAACCCGGGCTCGTCCTCACGACCAA
CGGCGTCTCGACGCTCGACAGCAGCAACGGCAGCAGCCTCGAACAGCTGCAGCGCGAGACTCAGCCACGAAAGCGAGAGG
TCGTCGGTCACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62