GenePrediction:GLEAN_3307 Details

Name: GLEAN_3307
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:525604..527304 (+ strand)
Length: 1701
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:525604..525867 (+ strand)
Length: 264
Type: CDS
Source: GLEAN
Position: GCSC_89:526291..526357 (+ strand)
Length: 67
Type: CDS
Source: GLEAN
Position: GCSC_89:526426..526566 (+ strand)
Length: 141
Type: CDS
Source: GLEAN
Position: GCSC_89:526630..526908 (+ strand)
Length: 279
Type: CDS
Source: GLEAN
Position: GCSC_89:526963..527080 (+ strand)
Length: 118
Type: CDS
Source: GLEAN
Position: GCSC_89:527142..527304 (+ strand)
Length: 163
>GLEAN_3307 class=GenePrediction position=GCSC_89:525604..527304 (+ strand)
ATGGCCGCGCCGCAAAAGCAACTGGGAGAGGTGGCATTTGAAACCCGGAAGCATCGGAGCTGGAGGACGTTTTGGAGGCT
AGGGCGACACAAAAAGACGCGTCTGTGGACTCAAGAACCCGGGCCCGACAGCGCTCTGCCTGTCTCTGGGAACCCTGCAT
GCGGTGGCTCCTCGTTCGTGAGGACACTCTGGCTGCTAATTGCTGACGTGATGCAACTGCTCATTGACGGCCACCTGTTT
TGGGGCCAAACGCACCCAATACTCGTATCTTACATGCAGGAGCCAAGCCGAGGATGTCGGATTAGCTAATGAAGGATGGG
GGCCGCCCAGTCTCATATTTAAAGACACTACAAAGGTACTCGCCGCAGGCGTCCACTCGCTTGGATTTGTTCTCTTTCCC
CTCGTTTCCGCCATTCTTCAGTTCTCCCGCCTGAGAAGAGCAATTGCGTTTGCGTTTCTTGCTTATTCCCAACAGCCCCT
ACTCGCGGATCTGTACTTGCCAACGACCATTGCCATGGACGCTCCCGAAATAGCTGGGTTTTGGGGTGCCAAGACTTCTT
ATTTAAAGTTGGTTTTACCCGCTGCTTATTATACATGCACAACCGGTTAACAACCCCTAGCTTCTGTGAAGAGGTATCTC
TCTACGCGTGCCTGCATCCGCCCTAACCGAGTAGTTGGATCTAACAGGTGAAGGATTATGTGATCACACAGTATATCGCC
GAGTTCATCAACACCCTCAGCAGCCTTGTGTTTGGTATGATGGCTTGGCAGCTCTAAAAGGCCCATCTCGGTCATGGGGC
CTCGGCTAACAAGCTCTTTTAGCTGCGTACGGTATGTGGGGGTTATGGCAGATCCGTCACAAGGCAAATGCCGCCTCTCG
TTCTATTCCGTACTTTGGGTTGATTGGTGTCGGCATCTGCTCTACTGGATACCACATGACCTTGAAATACCACACCCAAA
TGTGTATGTCGCCGTCGAGAGATTCTTTCTGTGTGTGATCGGCATAATCTAACTGGATATGTCTAGCGGATGAGTTCTCT
ATGCACCTATTGACGACGCCTCTCCTGTATAGGGTCATGACCTACAAGACTGACGCGGCATACACTCGTCGGGTTGGAAT
CATTCTCTCTGCACTGTTTGCAATTGTCATCACCACCCACATGGTCATGGACGAGTTTCTACTTCACGCTACGAGCTTTG
GCTTGGCCGTCTATCTTCTCGCCGCCGGGTCCCTAAAGATTATTTCAAAAGGCACGGACGAAAGCGTCAAGGGAATTCGC
CGAAAGCTGGTCATGTTTGGCCTGTGTGAGTCCCCCTGCGCCTGCATGTGTCGGACAATAACATTGCTAATGCGACAAGT
GAATTTCGTCATCGGGTATCTAGCCTGGCTGATCGACTCGTTTGCCTGCTTGACCTTGACCCGGATGCGAGAGTCGGTCG
GCCTGCCTTGGGCTTTCCTGTTTGAGTTTCATGGATGGTAGGCAGACTCCTCCTGGCATCATACACAACCCGGCTGAGTT
TCTAACAACTTTCATTAGGTGGCATGTTCTGACTGCTATTGGAGGCTACACGGCTGTCGCCACTCTTGATGCGGTCACTT
CGGATGAGGCTATCACCAGCTCTACAACATCTTTTGCCTGGCCTGTTCCGATGGCTGTGAGTTTCTTTGAGGGAGGCGAG
AAGGCTGCTAAGAAGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62