GenePrediction:GLEAN_3308 Details

Name: GLEAN_3308
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:531529..533380 (+ strand)
Length: 1852
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:531529..531800 (+ strand)
Length: 272
Type: CDS
Source: GLEAN
Position: GCSC_89:531862..533380 (+ strand)
Length: 1519
>GLEAN_3308 class=GenePrediction position=GCSC_89:531529..533380 (+ strand)
ATGTTCATCTTCTTCTTGTCTCTCGTGCTCTTGGCGGCCGCTGCGTCGGCCCAGAGAACCCAAGTCACTGTCGCCAACGG
CACCATCGAGGGCCTCACGTGTGTCCGCTCAGATGTGGTCTCGTTTCTATCTATTCCCTACGCTGCCTCCCCGCAACGCT
TCTCTGTCCCCAAACCGTACGACGCAAAGTACAATGGCAGCGGTCTTCTCATAGCAAAGACAGGCGCCCCCAGCTGTCCC
CAGTTCAGCGGCGCAGGAGGACAGGAGGACTGGTAAGCAAATCTGCTACGGGCTTCTAGACGGCCTTGCTGACCGGCGCA
CTGCCGCATGCAGTCTCTTCCTGGACGTATACGCTCCCGCCAACGCCACGGACTCGTCCAAGCTGCCGGTAAAGGTCTGG
ATCTACGGCGGAAGCAACGAGGGCGGAAGCATTTCCCAGCCGACGTACACGGGCTGTCTGGCTGCCGTGGACTCGCTCAT
GGTCAGCATCAACTACCGTGTCGGGCCTCTTGGCTTCCTGGCCCTCCCGGAGGCGAACCTCACCGGCAACTACGGCACGC
TCGACCAGCTGACCGCCCTCCGATGGGTGCAAGACAACATTGCCGCCTTTGGTGGCGACCCAGCTCGCGTGATGGTGTTT
GGCCAGTCAGCCGGCGCGCTGGACACCTTTGTGCTCAGCACGCTGCCCCAGGCCACAACCCTGATGTCTGCTGCCGCCAT
GGAGTCGGGTGGTGGCCGCAACATTCCCAACATCAGCGAGGTCGTCGACTGGAACCGAAAGTTCGCCGCCGCTGTCGGCT
GCACGCCGTCCGATGTGGCCTGTCTGCGCGGTCTTCCTCTGGCAACACTCCATTCAGCCGGCGTGACTGTCGAGCTCGCT
GTTGATGGTGCCTCGGCTCCGCCCACCGCCAACACCCTGCTGCAGAACGCCGGCAAGGGAGCCACCTGGGGCCCCGTGGT
CGACGGCACGATCGTGCCCCGACAGCCGGCCGAAGCGGGCGTGCAGGTGCCCAGCATTCTCGGCAGCAACACCCAGGACG
GCTCCCTCTTTGTCGTCGACCAGTACGGCCCCCATGCCCTGCAGCTCGGCTCCGACAGCTACGAACAGTTCCTGACGAGC
AACTTCGGCGCCCTGGCTGACTCTATCGAAAAGACCTTTCCGCTGGCTTCCTTTGAAAGCTCCATCCCGGCAGACCTGCA
GGCCCTCAATGCCACCACTGCCTACTTCGCCATGGTCAGCATCATGTCCCACGTCCGGTACACCTGTCCGGCCCGTCGTG
CCCTCATCTCGGCGGCTTCGCGTGGCATCAAGGCGTACGGTTACCTCTTCGATCACACACCATCGTGTGCCTGGTTTCCC
GGCATGTCCGACACGGAAATTCTCGGCCCTACCCACACGGCCGAAATCCCCTTTGTCTTGGGTCTGACGAGAAACTTGCC
ACCGCCTTCCGGCCACTGCAATCTCACGACGGCCGAGGACGACATCGCATCCTTCATGCTCGGTGCCTGGACAAGGATGG
CTGCTACCCGCCAGCCCACGACCGACAAGGATAGCAGCAGGTGGCCTGCTTGGAACGAGGGCATCGGTACAGGGCTGCTG
GTCGGCGCTGGCCAGGTCTCTACCGGATACATCAACTACAGCAGCTGTGATTTCTGGGATCAGGTCGAGGCCTCCATTGT
CAGGCTCGATGCCAGCGGCAACCTGACGGCAACTGCCTCTGCCTCTGCTGCCAGCAGCTCTCCGACGACGAAGAAGAAGA
GTGCCGGATGCCATGCTGCCGCTGCTTGGCCCGCTCATTACTCCGTTATTACTGCCATATTTTCCATCATCACTGCCGGC
TTTTTCTTGTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62