GenePrediction:GLEAN_3309 Details

Name: GLEAN_3309
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:535105..536521 (+ strand)
Length: 1417
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:535105..535524 (+ strand)
Length: 420
Type: CDS
Source: GLEAN
Position: GCSC_89:535588..535801 (+ strand)
Length: 214
Type: CDS
Source: GLEAN
Position: GCSC_89:535862..536070 (+ strand)
Length: 209
Type: CDS
Source: GLEAN
Position: GCSC_89:536135..536521 (+ strand)
Length: 387
>GLEAN_3309 class=GenePrediction position=GCSC_89:535105..536521 (+ strand)
ATGCCGGGACGTGAGACATCCTCCGCAGGGCTGTGGTTCGAGAAGCTCCCAGCCGATGTTCGTCAGTCTTCTGCTATTGG
AGCAGAAGTCCATTTGTCTTCAACCGTGCCCATCATTGACGTCGAGTCTCTTACTGAGGAGGACAAGGATGTGCTTCGGC
AAGCCTTGTTTGAGAATCAAGTCATTGTGATTCGCAACCAGACCGGCATTGATCCCAAGACGCTCCCTCAGCTGACAAAG
GTCTTTGACCCCTCTGCATCCGACATTCACTCGGCCGGCGAGAAGGCGGTCAGTGACCCGAGAAACATTCTGTCGGCGTA
CAAGGCGGGAAGAATCCCGAGAGCACCACAGGTGGGAATCATCGGAAGTGGCAAGTTTCAGAACTACGAGGGCCTCGACG
ATCTGGAGGTGATTCATCTGGTAAGAGCCAAGCGACAAAGCAACGCGCTTTTTGAAAGTATCTGTTCTGCTAACAAGTGC
AAGGATCATACCACTTTCCATGAAGAACCGTTGTCCAAGCAGGAGCTGGATGATGGCTATACCCGTCCATACCGATGGCA
CATGGACACGCCTTTCTACGAGCGCCTGCCGGGTGAAGTGACCATTCTTCATGCTGTCAAGGTTCCAGAGCTGCCGGACC
AGAAGCTCAAGTTTCCCGATGGGAAGGAAAAGGAAATCGCTGCCGGTGCTACAGCCTGTATGTTGACAGACGCTTCCTGT
TTTCCTTTCGTGCCACACCGCTGACCGAACGTCTTAGTTTTTTCCGGAGCGAGAGCCTTTGAGCTGCTCACGCCTGAAGA
GAAGGAGTTTGCCCTGAACACTACAGTGACATACGCCCCACAGGCTTACGAGTTCATCCGGCACTGCAAGTCTTCTGAGG
ATGGCCTGACGATTCCTACTATGGGGAAGGAGACCTCGATCGAAGCCTTGTCTGATTGGTCTTGGGACAAGGTGGCTGAG
CACCCGGTAAGTTTCGAGCAACCCTGAAACGGCGACGATTCAAATAACTGTGTCTGACACTTGCACGCAGATGGTGTGGC
GCAACCCGCTGAACCCTGATCGGCCGTTCCTGCAGGTGCACGGATGCTGTGTCTACAAGCTCACGACGAGAGATCCGGCC
ACGGGCGCAGAGTCGGTGATTGACGACGTCGAGGAGGTCCGCAACGTTGTGTACGGGTTCCAGAAGCGCATCTGGGCAGC
GGAGAATATCTATGCCCATCGGTGGGAAGCCGGTGATCTGGTCGTGTTTCACAATAGGGGCGTCATGCACAGCATCACCG
GGCAGCTGGCCCAGTACAAGGAAGACGAGGCCAAGAAGCGGCTCATGTGGCAGTGCACGATGACGAGCGGCACTGCCCCC
AAGGCTTTCCGCAAGTATCCCGGAGTGAACGAGACGGGCTTTGCAAGGGGAAACTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62