GenePrediction:GLEAN_330 Details

Name: GLEAN_330
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1115811..1120492 (+ strand)
Length: 4682
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1115811..1115945 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:1116002..1119052 (+ strand)
Length: 3051
Type: CDS
Source: GLEAN
Position: GCSC_167:1119115..1119249 (+ strand)
Length: 135
Type: CDS
Source: GLEAN
Position: GCSC_167:1119299..1119701 (+ strand)
Length: 403
Type: CDS
Source: GLEAN
Position: GCSC_167:1119754..1120053 (+ strand)
Length: 300
Type: CDS
Source: GLEAN
Position: GCSC_167:1120209..1120492 (+ strand)
Length: 284
>GLEAN_330 class=GenePrediction position=GCSC_167:1115811..1120492 (+ strand)
ATGCACGCCGAGGATGGAGACTTCAGAGAGCTAGAGACACGCTCTGAGAGAAACGGGCCACCGGGGCTCTATCGACTTGA
CTCGAACCAGAGCAGCGCCAGTGTCTTTGAGGATGTAGAGATGGCAAATGACCAGGTACGTTTAAGATCAGTTGTTGTAG
CGGGTCTGTCCCCATCGGCTAATGACTTCAGCTGTATTCGGGCCCGATGGCGGAGAGCCTCCCGAGCAGCATTGCGGCCT
TCTCGCACCGGCGGTCTCGCGCAGACTCAACGACCAGCTTTGCGTACTACACGGACGACGACGAAGAGCGTGATCGTATC
CGCCATCCGGCTGCTGCTGACAACGAGGATGATGACGTGTCCGTGTTTGAGGAGGCCGAAGGGCTGCTTGTCGGATCGTA
CGTGTCGTACGACCACCGGGGAGTGCGCTACCACCAAGACAGAGAGGACGACGAGGCTTATCGGGACGAGGACGACGAGA
GACACGGCAGAGATGACGAATCGGAAGGAGAAGAGGATGAGACAGAGGAAATGGACCGGGCCAGTGCAGAAAACGTTGGG
CTGCTTCACCGGCGATCGTCGACGCACTCACGGGCCTCTGTGCATAGCAATCTGCTGCGGCGGCGAAACAGCATGACGAC
GGAGGGTGGCAGCGAGTATGGCGGCGGACGGGTCAGCCAGAAGACGTACATCGTGACAGAGGACCTGTACCTGGTGATCG
CCGGGTTCCAGACCAGCCGGAGGGGGCAGACAGCATACATGGCCCTGTGTGTGGCCAGTCTCGGACTGGCCTGGCTCCTG
TTCCGATGGCTGCCGAGATGGCATGTCTGGATGGTTGGGCGGGCGTGTGAACTACGAGAATGCACATGGGTGGTGGTGGA
GAACCAGTGGAACGAAATGGCGATCCTGAATGTGCGCAGCACGCCGTACGGGCGGCCGCAGTCGACGGTGTTTGGTGCGG
CGACATACGCAGCCCAGGCGAGAAAGCTGGCGTCGTTTCGGGCAGGCAACGACTATGACGACGAAGCAGATCCGGATCCG
GACCCGCTACTGCAGCAGCTGCGTGTGCTTGACTACCGATACGTGCGGTTCTTCTACCACCCGCAGCGCGACAAATTTGT
GGTGTCGAGCGGGTGGAAAGACCCCAGCTGGCAGGACGTGCGGAAGATTCAGACGGGCATTGACGGCGACGAGAAGAATC
TGCGCGAGGTGGTGTTCGGGTCGAATCTGATTGACATTGCGCAGAAGTCGACGATGCAGCTGCTGGTGGACGAGGTGTTC
CACCCGTTCTATGTGTTCCAAATTGCGAGCCTGGTGTTGTGGTCGCTGGACGAGTACTACTACTATGCGGTGGCCATCTT
CCTGATGTCGTTTGGCAGCATCACGACGACACTGGTGGAGACCAAGGCGACGATGCGGCGGCTGCGCGACGTGTCGCGGT
TCGAGTGCGACGTGCGTGTGCTGCGCAATGGTTTCTGGCGGACGATCGTGTCGGGCGACCTCGTTCCGGGCGATGTCTAC
GAGCTTAGTGATCCGGGGCTCTCGCAGCTGCCCAGCGACAGCCTGCTGCTCAGCGGCGACTGCATCGTCAACGAGAGCAT
GTTGACGGGCGAGTCGGTGCCGGTGTCCAAGACGCCCATGACGGCCACAGTGCTGCAGACGCTCGACCTGGCCGCACCGA
CCGTCCAGCCTGAGACGGCCCGGCACTTTCTTTTCTGCGGAACCAAGATCATTCGAGCACGGCGTCCACAGCGGGATGCG
GGAGCACGTGATGGAACACGTGACCTGACGAATGGTATCGGAAACGGGAACGGAACCGAGGACGAGGACGCGGCGGTCGC
ACTGGCTCTGGTGGTGCGTACCGGCTTCAATACGACCAAGGGAGCGCTGGTGCGATCGATGCTGTTCCCGAAGCCGTCGG
GCTTCAAGTTCTACCGCGACTCGTTCCGCTACATTGCGGTGATGGGAGGCATCGCGCTGCTAGGCTTCGTGGCGTCGTTT
GCCAACTTTGTGCGACTGGGATTGGCGTGGCACTTGATTTTGGTGCGGGCGCTGGACCTGATTACGATTGTGGTGCCGCC
GGCACTGCCAGCAACGCTGACGATCGGTACGAACTTCGCGCTCAGCCGGCTGCGGGCACGACAGATCTTCTGCATCAGTC
CGCAACGCGTCAACGTAGGCGGCAAGCTAGACCTGATGTGCTTTGACAAGACAGGCACGCTGACAGAGGACGGTCTGGAC
GTGCTGGGTGTGCGAGTGGTGGACCGCAAGGCCAACCGGTTCGGCAGCCTGATCACGGACGCAGCAGCACTGGTGCCGGC
TCACCAGCCGATGGGAGGACCAGGCGATGTGGGCGGTACCGGTGATGACGAAAGCCGACGGGCAGCGCTGTTCACGATGG
CGACATGCCACTCGCTGCGAAGCGTGGACGACGAGCTAATGGGTGATCCGCTGGACCTCAAGATGTTTGCCTTTACCGGC
TGGGCCTTTGAGGAGGGTACTGGCGGCGGAGGCGGGGGAGGAGGGGTCGAGTTGCGAGAGCAGGGCGGAAACAACGACGA
GGACCAACAGCAGGGCGGACTGGCACCATCAGTGGCACGGCCGCCGGCCGAGTGGGTGTACGACCTGGACACACGGCCTC
CGGCAAGACAAAACTCCGCCTCACGGACCAAGACGCCGTTTGAGCTGGGCGTGGTGCGTTCGTTTGAGTTTGCATCGCAG
CTACGGCGAGCCAGCGTGATCGTGCGGGCGTTTGGGCAGAAGAGCGGCGACGTGTACGTCAAGGGGGCACCGGAGTGCAT
GCGCGAGATCTGCCGGGCCGAGAGCCTGCCGGCAGACTACGACGAGCTGCTGGCGTCGTACACGCACAAGGGCTACCGGG
TGATCGGCTGTGCGGCCAAGAATCTGCCACGGCTCAGTTGGGTGCGGGCGCAGAAGATGGCGCGTCACGAGGCCGAGGCC
GGGCTGGACTTTGTGGGCTTCATCGTGTTTGAGAACAAGCTGAAACCGACGACGACAGCGGTGCTAGACGAGCTGCGGGA
GGCCGATATCGGCACCGTCATGGTGACGGGTGACAACATCCTGACAGCCATCAGCGTGGCGCGTGAGTGTCGGCTGGTCA
GCCGGACGGCCCATTGCTTTGTGCCGCGTTTTGTTCAGGGACATGCACAGGACCCCAACGCGGAGCTGCAGTGGGAGAGC
ATCGATGACAGCATCTACCGGTTGGACCCGCGGACGTTGTTGGTGAGTGCTGTGTTGGAAGTGTTGGAGAGTCTTGGGCG
ACCTTGTTTGCTGACCATCTCCAGCCACTGCCTGCTCCTCCCGCAGGTGATGCTTCTCTGCCGTATGCCATCTCGGACCT
GCGCAACTATTCCGTTGCCGTCAGCGGCGACGTCTTTCGCTGGATTGTCGACTTTGCGCCCGAGGAGGTGCTCAAGAGGG
TTGGTCCTCCCTTTTCCTTTCTCTCCAATTCGCCACTGACACTCCCAGATGCTCGTTGTCGGCAAGATCTACGCCCGCAT
GTCGCCCGACGAGAAGCACGAGCTGGTCGAGAAGCTGCAGAGCATCGACTACTGCTGCGGCTTCTGCGGCGACGGCGCCA
ACGACTGCGGCGCCCTCAAGGCGGCTGATGTCGGCATCTCGTTGTCCGAGGCCGAGGCCTCTGTCGCTGCGCCCTTTACG
TCGCGCGTCTTCGACATCTGCTGCGTGCCCGAGGTTATCCGTGAGGGTCGCGCTGCCTTGGTTACCAGCTTCAGCTGCTT
TAAATACATGAGCATCTACTCGGCCATCCAGTTCACCTCTGTCAGCTTTCTCTACGCCTCGGCCTCCAACCTGGGTGACT
TTCAGTTCCTGTTCATCGACCTGGCCCTCATCCTGCCGATTGCCGTGTTCAGTACGTGTCTGCCTTGTCTTGTCTGACTG
TCTGCCGTCGCTAACCCATACAGTGAGCTGGGCCGGTCCGTTCCCTGAGCTGGGCAAGAAACGCCCGACGGCCGACTTGG
TGTCACGCAAGGTCCTGACACCACTGCTCGGCCTCATGGCCATCTCGGTCGTCATCCAGACCATCGCCTTTGTGACCGTG
CGCCAGCAGCCGTGGTTCGTGCCGCCCGTCGTCGATCCGGACAAGTCCAACATCAAAAACTCGGAGAATACGGCCCTGTT
CCTGGTCTCGTGCTTCGAGTACATCTTCTCGGGCGTCGTGCTCAACGCCGGCCCACCCTTCCGCCAGAGCTTGTGGCGCA
ACTGTAGGTTCCACCCGCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTT
GCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTTGCCTGCTTGCTGCTCTTTCGTCGCTGACTGTCTCTCAGGG
CCGTTTGTCGCCACCATTGCTGTCACCCTGGCTGCCACCGGCTACATGGTGGTCAACCCGGTGCACTGGGTCAAAAAGGC
GATGCAGCTGACCAAGATTAGCTGGAGCTTCAAGCTGGTCGTGTTGGGCCTTGGCCTGGCCTATCTCTTCGCTGCCAAGA
TAGCTGATGTCTGGGTGCTGCCAGCTGCGGCACGGCTGGTTGGGCGCGCCAAGCTGGCGCTGACCGGCCACCCAAAGAAA
CGGAAGGAGTACAAGCTGATCCTGGAGCGTATGCGGACATAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62