GenePrediction:GLEAN_3310 Details

Name: GLEAN_3310
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:542038..543936 (+ strand)
Length: 1899
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:542038..542781 (+ strand)
Length: 744
Type: CDS
Source: GLEAN
Position: GCSC_89:542842..543936 (+ strand)
Length: 1095
>GLEAN_3310 class=GenePrediction position=GCSC_89:542038..543936 (+ strand)
ATGAATGTATCGTTTTCCAGAGTATATGGGTGCATCGCCACTTTGACCGTCGCTCTCGTGCACGTTGCCCTTGGCCAGCT
CACGTCGACTGACTATGCCGAGTACAACGCCGGCAAGTTAGGACACCGGCCGTTCCAGCAGTTCCACTCCATCGACCAGT
TTGCTCCAGTGCTGCAGGTGACTACATGGAACAAGGCGGCGGTGTCGCAGACCGGATCGCACATCTTCATGCGCCATGAT
GGCCACGATGGATCACAGCTCTCGTCGCCGCTCATCATCGACGCCCACGATTTAAGCACCGTGTTTGTCAACCGCAGCTT
CGCAAACGTCTTTGGGACGCGCATCCAGCAGAACTTTGGCCGGAATTACCTTACCTTTTGGGAGGGGCAGAACAATGGCG
GCTTTGGCAATGGGTTTGGGCTTGCCTACGACGACAGCTACCGCCTAGCCTACAATATCACGGCCGACAACCCGAACAAT
ATGGACCTGCACGAGTTTGCCTTTACCGGCGACGGGTCTGCACTGGTGACCACGGTCGAGTGGCTACCGGCCGAGTCGCT
GAGCTGGCCGGTCCTAAGCCGCCTAGAAGATGCCAGCATCCGCGACTCGCGCTTCCAGGAGATCGAGCTCGAGACGAACA
AGGTGCTGTTCGACTGGCGGGCCTCGGACCACATCGACCCGGCAGAGTCTATGGAGCGGCAGACCCGACTCTGGGACCCA
TACCACCTGAACAGCATCCAAAAGGTAGGCTGTTTAGATCCGTTTTGTTTCCAAGGTTTAGGGACGTTGTGTTGACAAAA
GTAGACGAAAGCAGGCAACTATTTGCTGTCGATGCGCCATTTGTATTCGCTCCTTCTAATCGACGGGCGGACGGGTGAGA
TCATATGGAAGCTGGGTGGCCGAAAGAACGTTTTCAGCGAGCTGCCGCCGCCCAAAGGCATCAGCCTCAGCCGGCCTCTG
CTAAACCACATGCGCTGGCAGCACCACGCGCACTATGTGGCCGGGACCAACGAGACACAGATGACCATATTCGACAACTA
CCACTCGAAGCGGAGTAGCCGCGGAACCTGCGTCGAGGACTGCTCGCGCGGACTGCACATTACCATTAACGAGACCGCCT
CGCCGCCGACGGTGCAGCTGCTGAGCGAGTACCTTCATCCAGCGCGCATCCAGTCCCTGAGCCAGGGCAGCGTCCAGGTG
ATCGATCCCGTGTCCGGGCCTGGCCACGACATTGGCAACGTCTTCGTTGGCTGGGGCCATTGCCCCAGCTTCACGGAGCA
CACGGCCTCGGGCGACATCGTGCTTGACGTGCAGTTCTCGCCGTGGCACACGAGCAAGATCCAAGACGCGCTCAGCAACT
ACCGCGCCTACAAGATGGACTGGACGGCCACGCCGTACTGGGATCCGGCCATGGCTATCAAGCGGGACGAGCACGGCCAG
CTGGCCGCATATGTCAGCTGGAATGGAGCGACCGAAGTGAAGGAGTGGCTGATCCGCGTCGCCCATACGAACACCACCGC
CACCACCAGGATAGGCACTGGGGATCTGCTTGTGAGATCACCGCGAACCGGCTTTGAGACGGCCATGATGCTGGTTGCCA
CCAATCGGCGGTATGCCTGGGCGGAAGCTCTAGACAAGGATGGCAACGTGCTGCGGGCATCCAATGTGGTGGGCTTGCAG
TCAGCCGGGGCAGATACAACTCTGATAGTGCTGGGTGTTGGAGCTGCGGCAGTTGTCGTGCTGACGGGAGGGGTGGGTGC
TTATATGTGGCGGCGGCGTACAGGCTACACTCGCTTGCAAGGCGACAATATTGAGCTCGACACGGAGGTGAAGACTGCTG
ACACGACTGTCGGCGAGGATTATGATCATGGGTTTGAGGAAGCATCTCTACGAGGCTAA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62