GenePrediction:GLEAN_3311 Details

Name: GLEAN_3311
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:548154..549378 (+ strand)
Length: 1225
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:548154..548282 (+ strand)
Length: 129
Type: CDS
Source: GLEAN
Position: GCSC_89:548340..548487 (+ strand)
Length: 148
Type: CDS
Source: GLEAN
Position: GCSC_89:548546..549105 (+ strand)
Length: 560
Type: CDS
Source: GLEAN
Position: GCSC_89:549172..549378 (+ strand)
Length: 207
>GLEAN_3311 class=GenePrediction position=GCSC_89:548154..549378 (+ strand)
ATGCTGGCCATCGTCGCCGTCCTCCCATGGGGCGAGGGAAACCCGATAAAGTGTAGAAAGCTGCAGATACGCAAAGAATG
GCGGACGTTGACAAATGACGAGAAAGCCAAATGGGTGGGAGCTGTCAAGGTGCATCCTATTCCCCGAGAAGCCCCAAGAC
AACACCTACGTTGCTAATCTGGGTAGTGCTTGACAAGCATACATCACGAACGGCTTTCCTTCACGACGAACCGGACGGTT
CTCGAAGGAAAGAGGAGCCTGTACGACGACTTCTCTTACGCACACGCATCCCTCGAGCACAGCGCCCACGGGAATGCCTA
CTTCTTGCCGTGGCGTGCGTTACGTTCTTTCCCTTCCCCAGAACGTGTATAGAGTGCTTACCATTCACACAGACCGCTGG
TTCACATACCTATTCGACACTTCCCTTCGTGAGACTTGCGGATACAGAGGGCCAACACCCTACTGGGATTGGTCGCGAGA
TCATGCTGATCTGTTCAGTTCGCCCGTGTTTGAGGACTCACCAGAGTACGGACTCGGCGGCACGGGGGACTGTGCTTCCT
CGCCCGAGGCGGATTGTACCGTCACCACCGGTGCTTTTGCCTCGTCCAGCGAGAAGGGGGACTTCTCGCTTTCGTGGCCG
ATCCCCCATCCGCTGAGGAGGAATCTCACGCTCATCACCGGCTGGTTTGAAGGTGAGCGCCCGCAAAACAGCACACTCAG
CCCAGACTTTGTGCGCAACGCGACCGAGAAGACGACGGGCGACTTTTTCCGGTTCCAGGACGCTATGGAACGCATGCACG
ACCACGTACACAATTTCGTGGGGGGCGACATGGCCGGAGACTGTCCCAAAGCTCTGCCGGAAGAGAAATGCCAGGGAATG
ACGGCTAGCTTCACGCCGAACGATCCGCTCTTTTGGCTGCATCATGCGCAGCTCGACCGGCTGTGGAACGAGGTGAGCCT
GAGCCCATGATTGCATTCGAGAAAAGTAAAAGCGTTGACTTACTGAACCGCACTGCAGTGGCAACACCACCACCCGTCCA
ACTTTGCCGCCTTTTCTGGCATGCCCACACGTCCGCACAATATGACTGATGAACGCTACGACCCCAACGCACATGCAGAT
CATCGGATGTCTTTCGACGTGCAGAGTGTGCCAGTGACGCCGAGTATGGTTTTCGATACTAAGAGTTGGCCTTTGTGTTA
TCAATATACAAACGAGGACGACTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62