GenePrediction:GLEAN_331 Details

Name: GLEAN_331
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1121859..1123973 (+ strand)
Length: 2115
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1121859..1121998 (+ strand)
Length: 140
Type: CDS
Source: GLEAN
Position: GCSC_167:1122071..1122152 (+ strand)
Length: 82
Type: CDS
Source: GLEAN
Position: GCSC_167:1122215..1122317 (+ strand)
Length: 103
Type: CDS
Source: GLEAN
Position: GCSC_167:1122378..1122774 (+ strand)
Length: 397
Type: CDS
Source: GLEAN
Position: GCSC_167:1122835..1123026 (+ strand)
Length: 192
Type: CDS
Source: GLEAN
Position: GCSC_167:1123082..1123973 (+ strand)
Length: 892
>GLEAN_331 class=GenePrediction position=GCSC_167:1121859..1123973 (+ strand)
ATGGGCGTTCCGATGGCGCCAGACCCGCCATCGCGGCAGCTACACGCGAATGCTCACATGCGACCGCAATCGAGCTACGA
GGGCTGTTCCAGCATACGCGATTATGAGCTGCTGGGGAAGCTTGGCGAGGGCACGTTTGGGTGAGAGCTGACCTGGACCC
TTCTTCTGATGCGGCCGGTGGCTACCGCTTGGCGAAGCTGACACCACTCCAGAGAAGTGTACAAAGCAAAGGCACGACGA
AGTGGGAAAATGGTCGCCATGAAGAAAATCATCATGCACAATGAAAAGGACGGCGTTAGTAGCGTTCCCCCGTTTTTCTC
AGCTTTCACCTGGCTCTCTGACACCTACCGCCCCAGTTTCCGATCACAGCACTGCGTGAGATCAAGCTGCTGAAACTGTT
GTCCCACCCCAACGTGTTAAAGCTAGAGGACATGGCCGTCGAGCACCCTCACAAAGGCTGTACGTGCTTCTCCGGGTGAG
GTGATCGCTGCAAGACAGCCGTGCTAATCGGGAGTCCAGCTGATAAACGGAAACGACCGATCATGTACATGGTCACGCCG
TATATGGACCACGACCTTTCAGGACTGCTGGAAAACCCGTCGGTAAAGTTCTCGGAACCGCAGATCAAGTGCTACTTGAT
GCAGCTGCTCGAGGGCCTGCGGTATCTTCATGAGAACCACATCCTGCACCGCGACATGAAGGCTGCCAATCTGCTTATCA
ACAATCGCGGTATCCTCCAAATTGCCGATTTTGGTCTGGCCCGTCACTATGAAGGAGACGTGCCCCTGCCCGGCCGCGGT
GGTGGTGAGGGCCGGCGTGAATACACCAGTCTGGTTGTCACTCGTTGGTATCGTCCACCGGAGCTTCTGCTGCAGCTGAA
GCGGTACACCTCTGCTATTGATGTCTGGGGCGTGGGGTATGTTGTACCTCTGGTTTTTTGCACGAACCTTTGCTAATATT
CTGTCTCCCGTCCCAGATGTGTGTTTGGAGAGATGCTTGTGGGCAAACCGATCCTAGCCGGCATCAGCGACAGTCACCAG
TTAGAGATAATATGGGATCTTTGCGGCTCGCCAACAGAAGACAGCATGCCCGGGTGGAAGATGCTACCTGGCGCACAAGG
CTTGACACCTCGGCTGCGGCCAAGCAACATTTCCATGCGGTTTAGCAAGTATGTGGCCGACCACCTGCTCGCACTCTTTG
GCCATGACTGACAAGATGTACAGATACGGTCCTAGTGCGGTGTCATTGTTGACACAGCTGCTGAAGCTGGACTGGCGGTC
ACGTATCAACGCGATGGATGCGCTGCAGCACCCGTACTTCCGCACGGCGCCCTTCCCTGCAAGCCCGGGCGACATCCCGA
TGTTTGAGGAATCGCACGAACTCGATCGCCGGAAGTTTGACGACCGGAAAGCAGCCCTGCCCCCTGCTCCGAAAGGAGGA
ACGGTGGGCCGAGGGCATATGGAAGGTGCCAATGGACCCAACTCTGGCTTTGACGGCGACGGCTACGGGAGAAACGGGGC
GAATGGCAACCACCGACATGGCCAGCCAGGATACGCGAACGAACGGGTTTCACGAGGTCCAGGTGGCGGGCCAATGCCTC
CAAATGGCAATGGTGGTGGAGATGAAGGAGGTGTGCGACGGCCACCGTGGGCACGCGATCGTCAGCCGCACGGATTGCCG
CCGAGGCCACCGCCACCGACAACCGGTGATCCTCTTGTCAACGGACGAGACAACCTCAACTATGGCGACGGATATCGTGA
CCGGGACCGTGACCGGGACCGCGATCGAGACCGTGACCGCGATCGAGACCGGAGCCGGAACGAGCGCTATGGGCCACCAC
CACGAAGCCGAGGGGGGCGAGACAATGACATGGACACGTACATACCGGTGGCACGAGGCTATCCGCGAGGAGACGGTGTC
GCGGCGCGTGATGCCAACCGCGATGTCGCTCGTGATAGGCTACCACCGGCGCGAGAGGAGCGTCGACGACACGACGATCG
GGATGAGCCGGCACGGCACACTGGACGAGACCGACATGATGGACCAGTGCGTCACAGCAGGAGCCGATCGCCCTTGCGTG
AACGCGACAGAGACAGAGATGCTTATCGGAGGTAG

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62