GenePrediction:GLEAN_332 Details

Name: GLEAN_332
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_167:1124630..1128466 (+ strand)
Length: 3837
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_167:1124630..1124741 (+ strand)
Length: 112
Type: CDS
Source: GLEAN
Position: GCSC_167:1124866..1125021 (+ strand)
Length: 156
Type: CDS
Source: GLEAN
Position: GCSC_167:1125293..1125703 (+ strand)
Length: 411
Type: CDS
Source: GLEAN
Position: GCSC_167:1126146..1126225 (+ strand)
Length: 80
Type: CDS
Source: GLEAN
Position: GCSC_167:1126289..1126712 (+ strand)
Length: 424
Type: CDS
Source: GLEAN
Position: GCSC_167:1126773..1128466 (+ strand)
Length: 1694
>GLEAN_332 class=GenePrediction position=GCSC_167:1124630..1128466 (+ strand)
ATGGCCAAGATATGTCTTCGCGCCGATGCCCAGCAACAGCAGTCGGCAAACGCCATAGCTCCTTCCCGGCGCCCTCTCCA
ATCAGAAGGCCCACTTGGCCAGTCTGGGACGTGTAAGACGATGTGTGCCCAACACGGCCTAGTGCTTTCCCCTGAAGGAC
CAGGGGGCGGCACGCCGTTTCTCCTCGTTACATAGTACGGCGCCTACACACGCTAATCCAGATACATACATCGCAGTATC
GCAGCATGCGTGTCAGACGCCGGTCGTTCCTGCCGCCCCCCTTTTTTCTGCCACCTTCCGCCAATACCCTGCTTCACGTT
CCTGCGTCCCTGCCAATTGGGACCCCAGCCGCTCGATTGAGTATGAGGAAGATACGGAGTACTTTGGCGCTCGTACGCAA
TCGAATGGGTCTCTTCTCTTTTGGGCTAACTGGTACGCAACCACCCCTCCGAGACCTGCCAGACATGAGCTCTGATAGCC
TCCGGCTGCTTTCTGGGCCTTCCTCCACCCCGGTCCTGGTTTAAGATATCTTCCATAGCAGTCCTCTTCATCCCGTTTTC
GGCCAGGCCTCTTTGCATGCGGCCTGCTCTTTGCAGAAAGCAGTCGTCTTGCTTGCCACTCGTTCGATACAGAAACGCCC
AAACAAAACAAACGTGCCCACAGTGCAGCCTGAGACGTGCATGTATCTTTATTTTGGGATCCGCTTCCTTGTCGCAACAC
AGACTGCAGCTGCTCGCCGATCAAACGTCCTTACCGCAGCCCCCTGCTCGTCCTCGTCCGACTCGTCTGGCTCGTTCGAC
TTGCGCCTGGAAAAAGACGGATGTCGCATCTTCAGCCAGCGGGCAACCTCCAGCGCCTGCGAAGGCTTCGGCCTCGTCGC
TGCGGACCAGGCCACCCCCCCTGTCTTGCCCTCCCACCTGCATCTTACAAAGGTTCATTATGTCGCCCACTGCAGTCTAG
CAAAGGACCAGCATCATCTACGCTCTCTTGACGTCGCCTTCGTGTCGCTCGTTCTCGTCACTTTCCACCCTCCTTTGGTA
CTGGGTCTCTCGTTCAGGACCTGCGTATTCTCTGGTCGACCCACTGGCCCTGGCGTTTCTCCCTGTCGGCCCTGCCATTA
CCCGTCCATGTCCTCACCCTGCGTCGCCCGCTCTTCGGCGCTCCAGTGCTTCACGTCGTATTAACCGATCTCCCCTTCTC
GGCCCCTCCCTTTTGTCTCGCGCGTGGCCACCTACTTCGTCTCGTGTCCACCGCGACGACGTCTGTTTGTCTTCCATTCA
CTTCTTCTTTCAACAATAGGATCACGGTCGACTACCATCGCTGGCGAGGAGCGACTTGTGCACACGGCCGGTCCGATTTT
ACCCTTCTTTTCTTCAATCCGACTGTGTCGAGATTTCTTTTCGCTTTTCTTTTTGATTTTCTCTTCAATTTTCTCTTCGT
TTTTAGGGGTTTAATTTTGTTGCACGACCGGCGGCGTCGAACACAGTACTATATCATACCCTTTCGAATTAAGCAGCAAA
TTTCGGCACCATGGGTTTCATGAGCCACCGCCAGAAGAATGTCGAGCTTCGGCCAGAGCAGAAATGGGACTACATTGTGA
GTAAATCGGTCGGCATGTTGCGACTGCATGTCCGATTCACGTCTAACCATTGCCGCTAGACCTTGAACGACTTCAAGTCA
ACGTCCTGCTTGACACCTTTGGCCTACGGCTATCTCTACCTGTCTCTTCTCCTGTCCACTGCCGTCTATGCCGTCGATAC
ATTTACTGCCGTCAACCTGCTGGTCTTTAACAAATGGTCCTCTGAGATCAGCCCGGCAATCTCTTTCACGGCCGCCAAGT
GGATCTTCTCCGTCTGCATCATATTGTCCTTTCTCAATCTAGCCTACGAGCATATCCGTGCCCAGCTTGTCATGAGACGC
GGCAGCGTCACCGAATGCTACCTGGACAATCTGGCCGTCCGCCTCGAGAGCATTCGATGGGGCAAGGGCCAAGGGTGGAA
GCGCTTTCTGGTCATCGCCGCGTTGACCAAAAGTAAGAAGGGTTCCGAATACATCGCCCTCTTCACTTATTTCAGCTTTC
AATGTAAGCCACGCTCTGTTTCGTTCCCACCACTCTGTATTGTCCCATACTGACACGTATCAGCCTGGATTCGCATCCTG
CTGTGCTCTGGTCCCCGCCAAGTCGTCAACGCCCTTACCTTGTACTCCGTCTACAACGCAAAGCTCTTCGTCACAGGTGA
CAATGTGGCAAACACTTTGAAGAACTTCTTCGAGAAGATTCGCGAGCTGGCCGAGGAGAACTCGCAGCAGGCCCTTATCC
TCTCTTCCATGCTCTTCACCCTAATCATTTGGATCTTCTCCTTCCTCTCTCTGCTCATCGCTTTTCTTTTCTTCGCCTTT
TACCTTTGGAGCTACATCCCTAAGTCGGATGGTAGCCTGTCCGCCTACTGTTCGCGGAAGATCAACAAGCGTCTCATGCA
GATCGTTTCTGTCAAGGTCAACGCTGCTCTTGCCGAAGAGGAGCGTCGCCGGAAGAAGGCCGGGTTCAAGGCTGCAAAGA
AGGCTGGCGAGCTACCACCGGCTGAACAGAAAGCCACGATTCCGAATGTTGGCTTTAACTCTCCGCCGAGCCTGCCCAAG
ATGGAGCGCACCGACACCATGGCCACACTGCCCCCGTACACTTCCCAGCCAGCCACACCAGGTGGCTATGGGCTGGGCGC
CATTGACCAGAAACGGCCCATGCCTTCTAGGTCCGGCACGCTGCCATCAAGCGTGCCGCCAGGCAACGGCAACTTCTCCA
CTCGCGCGTCTCTATTGAGATTTGCCGCCGAACCGGGCATGGGCAACGTCCGGTCTGCCTCGCCGGCTCCTTCGATCCCC
AATCTGACAGGGATGCGCGACAGCGAACTCAACAACGGGTACCCTCGTCCGCCAATGCGCTCGGCAACTGAGGCTCCCAA
CTTCTCCTACCGAGGTGGCTCAGCAACACCACCCAGGCAACTGAACCGTACGAACACTGCCGGCTCAATGGCACCTGCTT
CAAACGGCAGCTTCTCAAACATGCCGCAGCGTGTTCAATCCCCTGCGCCTTACGCCAGCCGACAGCAGCAGTACAACAAC
GGGCCAAGCATACCGAACCACAGGTCCAACGGGTCCAACGGGTCCAACTCCAGCAACCGCTTTGCCGCCTACCAGGATGA
GACAGGCCGGTCAAGCCCAGCTCCTTCAGTGCGTGCATACGGGCCTGGCGGAGGCTTCAACGCACCCAGCCAGTATAACA
CCAACTTTTCCGCTTCGCCACAAGGCATGCCGGCACGGATGCGGAGCGCCACCAACCCTGTGCAGCGACGGGTCTCTCAG
AGTGGCACTGGGTTTGGACAGGTGCCGTTCAAGCAGTCGTTTGCCCCTCAGCGAAACATGACAGCTCCTTTGCCGTCGTA
TGAACACCAACGCCAGGACTCGAATGAGAGCTACGCATCGTATTTCGAGTCGCCAGCTGCGGCTCCTGTCCAGTGGTCGT
TTGCACCGCAGCGGGGCATGACGGCACCGGTGCCGTCGTACGCACACCTGCGCCAGGACTCAAATGAGAGCTACGCATCG
TATTTCGAGTCGCCAGCTGCGGCTCCTGTCCAGCGGTCGTTTGCACCGCAGCGGGGCATGACGGCACCGGTGCCGTCGTA
CGCACACCTGCGCCAGGACTCAAATGAAAGCTACGCTTCGTATTTCGAGTTGCCAGCTCCAGCTCCAACCCAGCAGCCAT
CGCAATCTCGGCCTGCGTATGGAAACAACAGCTGGAACACGGACGTTGAATCGCAGAATGGGCCGGGCCGTTACTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62