GenePrediction:GLEAN_3330 Details

Name: GLEAN_3330
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:691564..692867 (+ strand)
Length: 1304
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:691564..691728 (+ strand)
Length: 165
Type: CDS
Source: GLEAN
Position: GCSC_89:691799..692531 (+ strand)
Length: 733
Type: CDS
Source: GLEAN
Position: GCSC_89:692617..692867 (+ strand)
Length: 251
>GLEAN_3330 class=GenePrediction position=GCSC_89:691564..692867 (+ strand)
ATGGCACCACCATCTGCCGTCGAGACCGTAACGGTGCCGACAAAGCTGCAGCCGCTGAAGCTGCACACGACCACTGCAGC
AACGGGCGACTACAAGCAGCTGTCGCCGGCCGAGATCGACCGGGAGGGAGAGGAGCATGGTACAGACAAGTTTGCCGCAG
CCAAGGTGGGTTTCCGGTGACGGCAAGTGCATGAAGGCGCTTCCCGGCTGACTCCAGCTTTGCGCTGTTTCGCAGTACAC
AAACTACCTGCCGACATGGGACCACACGGAAAAGTACCCGCCGCTGGTACCGTTTGAGCACGTGGAGCATGGCAAGGATG
CGGACCGGACGTTCCCGGACCTGTTGCCGGCGACGGCACAGGTAACGGAGCTGACGCCGACGACGGGCAGTGAGGTGCGT
GGCGTGCAGCTGAGCCAGCTCTCGGATGCAGGCAAAAACCAGCTAGCACGGTTCGTGGCCGAGCGCAAGGTGGTAGCCTT
CCGGGAGCAGGACCTGGCCGATCTGCCGATCGCGGACGCGCTCGCGTTTGGTGGCTACTTTGGGCGTCACCACATCCACC
CGACGTCGGGCCAGCCGGCCGGCTATCCGGAGATCCATCTGGTGCATCGCGGTGCCGGCGACAAGTTTGCGGAACAGTTC
TTTGCCACGCGCACCAACAGCGTCGCCTGGCACTCGGACGTCTCGTACGAGCTGCAGCCGCCCGGCACCACGTTCCTCTA
CATTCTTGACGGCCCGGCCAGCGGCGGCGACACGCTCTTTGTCAACGCCGCTGAGGCGTACAACCGCCTCAGCCCGGGCC
TGCAGCAGCGCCTGCACGGACTTCAGGCCACCCACTCCGGCATCGAGCAGGCCAACACCAGCAAAGCCCGCGGCAGCATC
ACGCGCCGCGAGCCCGTCTTCCATGCCCATCCTGTTGTGCGCACTCACCCGGCCACTGGCGAGAAGGCCATCTATGTGAA
CCCGCAGTGTATGTCTTTGCTCTCTTCTTTCTTCCTTTCTTCCTTTCTTCCTTTCTTCCTTTCTTCCTTTCCCTTGTTCC
CGCTGACCATCAGTCACTCGCGAGATTGTCGGCTTCAAAAAGGAAGAGTCCGACGCTCTGCTCAAGTTCCTCTACGACCA
CCTCGCCTATGGCGCCGACTTCCAGGCCCGTGTCAAGTGGGAGCCCGGCACTGTCGTCATCTGGGACAACCGCGTCACCC
AGCATTCTGCCCTCGTCGACTGGAGGAGCGGCGACCGTCGCCATCTGGCACGCATCACGCCCCAGGCCGAGCGGCCGTAC
GAGACCCCGTTCGTCCCGGCTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62