GenePrediction:GLEAN_3332 Details

Name: GLEAN_3332
Class: GenePrediction
Type: coding
Source: GLEAN
Position: GCSC_89:701279..702747 (+ strand)
Length: 1469
Score: 1
ProbFraction: 1
Parts:
Type: CDS
Source: GLEAN
Position: GCSC_89:701279..701293 (+ strand)
Length: 15
Type: CDS
Source: GLEAN
Position: GCSC_89:701597..701831 (+ strand)
Length: 235
Type: CDS
Source: GLEAN
Position: GCSC_89:701976..702416 (+ strand)
Length: 441
Type: CDS
Source: GLEAN
Position: GCSC_89:702518..702596 (+ strand)
Length: 79
Type: CDS
Source: GLEAN
Position: GCSC_89:702657..702747 (+ strand)
Length: 91
>GLEAN_3332 class=GenePrediction position=GCSC_89:701279..702747 (+ strand)
ATGGCAACCGAACAGGTGAGTTGGCTATGCGAAGCGCTTTGGCGGCGTCGCTTTTCGCTAGAGTTTACTTGTCTGAGTCA
TCGGCCCCCCTCCTTCCCGTTCGTTGGTTGGGCGGCTTAACCCCGCCGTTGCACAGTGCCACTAGGAGGGCTTTGCCAAT
TTTGAACAAAAAGAAAAAGGAACGGGGCAAAAAACAGAACAGAGTTTCCGATTGAAAGCGGACCAAGAACAACCACATCA
GGCTCTACCTTGAAACTCCCTTTTTTGTGTTGTGATTTCGGAAACGCAAACCCCTTTATCCTAACGCTTGAACTGCAGCT
ACCTGAACGTAAAGCCCGGAAATCGGTCACATTTACGGATCAAGCGCTTGTGATTGACGCAGACGGAACCGTCAGCATGC
CTCCGACGGAAGCGATCAACGACGACAAGGACACGGCCGTGTCCCACAGCCCGCGGACACCGCCCCTGGCGGCAGCGGCT
GGGGCCTTTGCAGAGGCGCGCCCGGACGATGAGGCGGCAGCAGCAACGGCCGGCGATGACGGCCTGGACCTGAGTCTGCT
GAAGAAGAAGAAGAAGAAGAGCAGCAGCAGCAAGAAGAAGGCAGAGGGCGAGGATGGTGCGGAGGGCGCGGCGGCCGGCG
AGGACGGCGGGCTAGACCTCAGCCTGAAGAAGAAGAAGAAGAAGAAGGCGATCAAAGACAAGGCGGGCGAGGACGAGTTT
GCGGAGAAGCTCAAGGCGATGGAGCTGCGGGACGAGGAGGTCGTCGAGGTGGACGAGGGCGACATGGAGAAGGGCACAGG
CATCTGGGAGCACGACGCGTCGAACCCGCCGGTGCCGTTCTCGCTGCTGCTGCACCGGTTCTACCACGTGCTGGAGCTCA
AGAACCCGGACCACGCGACGAGCGGCACGCGCAGCTACAAGATCCCACCGCCGCAGTGCATGCGCGAAGGCAACAAGAAG
ACCATCTTTGCCAACATTGCCGAGGTGGCCAAGCGGATGAAGCGTACGGAGGAGCACATTACGCTGTACCTGCTGGCCGA
GCTGGGCACGACTGGTTCGGTCGACGGCAGCCGGCGGCTGGTCATCCGTGGCCGCTTCCAGCAGAAGCAGATCGAGAATG
TGCTGCGGAAATACATTAGTACGTTGTGACCCCGTTTCGGGTGGCCGTGGCCGTGGCGTGACTGTGTGCCATGACCAACG
TCTTGTTCGTGTTCAGAACCGAACGGCTAACCAGAACAGTCGAATACGTCGTCTGCAAGACGTGCAAATCGCCCGACACA
GAGCTCAGCAAGGGCGAGAACCGGCTGTATTTCATCACGTATGTTTTCTTTATGGCTCTTGTCTGGCTTCAGAGACTTTG
AAGTGCTAACCTGCCCAGGTGCAACTCGTGCGGTTCCAGACGGTCCGTCACGGCCATCAAGACCGGTTTCTCGGCCCAGG
TCGGAAAGAGAAAGAAGATGCAGGGTTGA

$Id: blue_fungus.conf,v 1.8 $

Note: This page uses cookies to save and restore preference information. No information is shared.
Generic genome browser version 1.62